SummaryRMgm-4138
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene mutation |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 28414172 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 2.34 |
Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | Tremp AZ; Dessens JT |
Name Group/Department | Pathogen Molecular Biology Department, Faculty of Infectious and Tropical Diseases |
Name Institute | London School of Hygiene and Tropical Medicine |
City | London |
Country | United Kingdom |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-4138 |
Principal name | ∆PTX/EGFP |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Normal numbers of oocysts are formed. Highly reduced formation of sporozoites within the oocysts. |
Sporozoite | Normal numbers of oocysts are formed. Highly reduced formation of sporozoites within the oocysts. |
Liver stage | Not different from wild type |
Additional remarks phenotype | Mutant/mutation As an internal control for the LAP1∆SRCR/GFP parasite (RMgm-115) we also generated a new parasite line named LAP1∆PTX/GFP, which expresses LAP1::GFP without its pentaxin (PTX) domain. Like LAP1∆SRCR/GFP parasites (RMgm-115), LAP1∆PTX/GFP parasites failed to form crystalloids and generated oocysts, the large majority of which failed to produce sporozoites. However, compared to LAP1∆SRCR/GFP, pull down from LAP1∆PTX/GFP ookinetes yielded considerably higher levels of LAP4, LAP5 and LAP6, albeit the amounts were reduced compared to ookinetes expressing the full-length LAP1. These observations indicate that the SRCR and PTX modules of LAP1 contribute differentially to the formation of the complete LAP complex. Moreover, the very similar phenotypes of these LAP1 mutant parasites indicate that the relative amounts of individual LAPs within the complex is equally important for its function. From the abstract: Other mutants RMgm-115: A mutant containing a mutated form of PbSR: Two central SRCR (scavenger receptor) domains removed |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1035200 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1407000 | ||||||||||||||||||||||||||
Gene product | LCCL domain-containing protein | scavenger receptor-like protein | ||||||||||||||||||||||||||
Gene product: Alternative name | PbSR; P. berghei Scavenger Receptor-like protein; PSLAP; LAP1; CCP3 | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Short description of the mutation | The pentaxin (PTX) domain removed | ||||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||||
Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||||
Restriction sites to linearize plasmid | KpnI/SacII double digest | ||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | To study the role of the pentaxin (PTX) domain of LAP1 we generated by allelic replacement a parasite line expressing LAP1::GFP without its PTX domain, named LAP1∆PTX/GFP. One μg of plasmid pDNR-PbSR/EGFP served as template in PCR using primers deltaPTX-F (GGCTAGCTGATGGTATGTCTGGAAATAGAGACATAAATAC) and deltaPTX-R (ATACCATCAGCTAGCCATTGAAAAGTTGGTTC). After PCR amplification the template DNA was digested with DpnI and the amplicon DNA circularized via In-Fusion PCR cloning to give plasmid pDNR-deltaPTX/EGFP. The LAP1-specific insert contained within pDNR-deltaPTX/EGFP was then introduced into pLP-DHFR/SR via Cre-LoxP site-specific recombination to give the transfection vector pLP-deltaPTX/EGFP. Prior to performing transfections, plasmid DNA was digested with KpnI and SacII to remove the vector backbone. | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |