RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-401
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1137500; Gene model (P.falciparum): PF3D7_1361400; Gene product: actin-depolymerizing factor 2 (ADF2, actin-depolymerization factor 2)
Phenotype Oocyst; Sporozoite; Liver stage;
Last modified: 17 June 2010, 10:03
  *RMgm-401
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20529666
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherY. Doi; H. Kanuka
Name Group/DepartmentNational Research Center for Protozoan Diseases
Name InstituteObihiro University of Agriculture and Veterinary Medicine
CityObihiro
CountryJapan
top of page
Name of the mutant parasite
RMgm numberRMgm-401
Principal nameΔADF2
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal numbers of ookinetes are formed that showed normal invasion/traversal of the midgut wall. The number of mutant oocysts was reduced, to 30% of the number in wild-type. The number of sporozoites per oocyst was comparable between the wild type and mutant parasites.
SporozoiteThe number of mutant oocysts was reduced, to 30% of the number in wild-type. The number of sporozoites per oocyst was comparable between the wild type and mutant parasites.
Liver stageThe in vitro transformation rate of mutant sporozoites into 'spherical stages' (EEFs?) was reduced to 20–50% of the wild-type rate (see also 'Additional remarks phenotype').
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of ADF2 (actin-depolymerizing factor 2).

Protein (function)
The actin-depolymerizing factor ( ADF)/cofilin family (AC proteins) are ubiquitous eukaryotic proteins that modulate the turnover of the microfilament system. ADF/cofilins bind F-actin in a 1:1 stoichiometry per actin subunit, an interaction that drastically destabilizes the polymers. The ADF/cofilin-induced acceleration of F-actin turnover is largely responsible for the rapid microfilament remodeling. AC proteins also bind monomeric actin (G-actin).
Two Plasmodium genes have been identified with homology to ADF/cofilin genes (ADF1, PFE0165w/ PBANKA_110310 and ADF2). Sequence comparisons showed that both Plasmodium ADFs share roughly 20–30% identity with yeast, plant, and animal ADF/cofilins. ADF1 lacks the F-actin binding residues of the AC consensus.

Disruption of the ADF1 gene of P. berghei (PFE0165w/ PBANKA_110310) was not successful in four independent transfection attempts (RMgm-388), indicating an essential role during asexual blood stage growth/multiplication.

Phenotype
Phenotype analyses indicates a (minor) role of ADF2 in the ookinete-oocyst transition and suggest that ADF2 plays no role in ookinete motility. Limited evidence is presented for a (minor) role of ADF2 in the transition of sporozoites into early liver stages ('spherical stages' produced in DMEM culture medium at 37°C; EEF transformation has not been analysed in cultured hepatocytes).

Additional information
Based on limited phenotype analyses of ookinetes, oocysts, sporozoites and 'transforming' sporozoites (mainly analyses on the light-microscopy morphology and numbers of these stages) it has been suggested that ADF2 is involved in the 'rounding transformation' of both ookinetes and sporozoites.

The phenotype analyses are performed with only a single mutant parasite line. Usually mutant phenotypes are confirmed using two independent mutants or by restoration of the wild type phenotype by complementation of the mutant with a wild type copy of the gene.

Disruption of the ADF1 gene of P. berghei (PFE0165w/ PBANKA_110310) was not successful in four independent transfection attempts (RMgm-388).

Other mutants
RMgm-388: unsuccessful attempts to disrupt ADF1 (PBANKA_110310; PFE0165w; actin-depolymerizing factor 1)

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1137500
Gene Model P. falciparum ortholog PF3D7_1361400
Gene productactin-depolymerizing factor 2
Gene product: Alternative nameADF2, actin-depolymerization factor 2
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe wild-type P.berghei ADF2 genomic locus was targeted with a KpnI-linearized replacement plasmid containing 5′ and 3′ regions of the ADF2-untranslated regions and the human DHFR selectable marker gene (hDHFR).
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CAGCGGCCGCGCTTTCTAGTATTTAAATGACCAT
Additional information primer 1ADF2 5′ forward (NotI)
Sequence Primer 2CAGGATCCTAACTCCTGAAACCATTTTGACGCAC
Additional information primer 2ADF2 5′ reverse (BamHI)
Sequence Primer 3CAACTGCAGTAGGGATTATATGTATTCCCTTCCCA
Additional information primer 3ADF2 3′ forward (PstI)
Sequence Primer 4CAGGTACCATATGTTATTATTACAGCCATGTTTC
Additional information primer 4ADF2 3′ reverse (KpnI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren