RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-4
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0522700; Gene model (P.falciparum): PF3D7_0422300; Gene product: alpha tubulin 2
PhenotypeNo phenotype has been described
Last modified: 16 January 2017, 11:49
  *RMgm-4
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification ≥ 5
Reference (PubMed-PMID number) Reference 1 (PMID number) : 16115694
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherT.W. Kooij, C.J. Janse, A.P. Waters
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0522700
Gene Model P. falciparum ortholog PF3D7_0422300
Gene productalpha tubulin 2
Gene product: Alternative name
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationAlpha-tubulin II is one of the two alpha-tubulin genes (I and II) in Plasmodium. This gene is highly expressed in male gametocytes. Expression was also observed in the asexual blood stages, female gametocytes, ookinetes and oocysts (additional P. berghei gene models: PB001519.02.0-PB300720.00.0-PB000609.00.0). The paper describes two different constructs that have been used in attempts to disrupt alpha-tubulin ii; pL0103 (for details see below) and pL1006 (details not shown).
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCAAGCTTGGATCCTGTAGATATATCCACATTTTACA
Additional information primer 1Primer L468; 5'UTR Pb alpha-tub II
Sequence Primer 2CCCAAGCTTGCTAATAACTTCTCTCATTTTCG
Additional information primer 2Primer L469; 5'UTR Pb alpha-tub II
Sequence Primer 3GGATATCCATCACCACAGGTTTCTACTGC
Additional information primer 3Primer L470; Exon 3 Pb alpha-tub I & II
Sequence Primer 4GGAATTCAAACTTCAGCAATAGCAGTTGAG
Additional information primer 4Primer L471; Exon 3 Pb alpha-tub I & II
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren