| top of page |
| Type and details of transgene |
| Is the transgene Plasmodium derived |
Transgene: Plasmodium |
| Gene Model of Parasite |
PBANKA_0813000
|
| Gene Model P. falciparum ortholog |
PF3D7_0911900
|
| Gene product | falstatin | inhibitor of cysteine proteases |
| Gene product: Alternative name | inhibitor of cysteine proteases; ICP |
| top of page |
| Details of the genetic modification |
| Inducable system used | No |
| Additional remarks inducable system |
|
| Type of plasmid/construct | Plasmid single cross-over |
| PlasmoGEM (Sanger) construct/vector used | No |
| Modified PlasmoGEM construct/vector used | No
|
| Plasmid/construct map |
|
| Plasmid/construct sequence |
|
| Restriction sites to linearize plasmid |
SacII, ApaI
|
| Selectable marker used to select the mutant parasite | tgdhfr |
| Promoter of the selectable marker | pbdhfr |
| Selection (positive) procedure | pyrimethamine |
| Selection (negative) procedure | No |
| Additional remarks genetic modification | An insertion construct containing a C-terminal GFP-tagged version of pbicp was used that integrates through single cross-over homologous recombination into the c/d-ssu ribosomallocus. The disadvantage of using an insertion construct is that the construct can be removed from the genome, thereby restoring the wild type genotype. |
| Additional remarks selection procedure | |
| top of page |
| Other details transgene |
| top of page |
| Promoter |
| Gene Model of Parasite |
PBANKA_1133300
|
| Gene Model P. falciparum ortholog |
PF3D7_1357100
|
| Gene product | elongation factor 1-alpha |
| Gene product: Alternative name | eef1a |
Primer information details of the primers used for amplification of the promoter sequence 
Primer information details of the primers used for amplification of the promoter sequence
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
|
|
| top of page |
| 3'-UTR |
| Gene Model of Parasite |
PBANKA_0719300
|
| Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative |
| Gene product: Alternative name | dhfr-ts |
Primer information details of the primers used for amplification the 3'-UTR sequences 
Primer information details of the primers used for amplification the 3'-UTR sequences
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
|
|
| Insertion/Replacement locus |
| Replacement / Insertion | Insertion locus |
| Gene Model of Parasite |
Not available
|
| Gene product | Not available |
| Gene product: Alternative name | small subunit ribosomal rna gene (c-type unit) |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
| Sequence Primer 1 | CTGGGATCCATGAAAAGTATAACTTTTTTCGTGTTTAAT |
| Additional information primer 1 | PbICPpL17-fw (BamHI) |
| Sequence Primer 2 | CTGGGATCCTTGGACAGTCACGTATATAATTTTAGTGTT |
| Additional information primer 2 | PbICPpL17-rev (BamHI) |
| Sequence Primer 3 | |
| Additional information primer 3 | |
| Sequence Primer 4 | |
| Additional information primer 4 | |
|
|
| top of page |