top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_0708100
|
Gene Model P. falciparum ortholog |
PF3D7_0822500
|
Gene product | dynein light chain 1 | leucine-rich repeat protein |
Gene product: Alternative name | PbDLC1; DLC1; PfLRR7 |
top of page |
Details of the genetic modification |
Name of the tag | c-myc |
Details of tagging | C-terminal |
Additional remarks: tagging | |
Commercial source of tag-antibodies | |
Type of plasmid/construct | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | hdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | Negative attempts to tag the dlc1 gene of P. berghei with GFP suggest that dlc1 is essential for blood stage development. In the same study negative attempts are reported to disrupt or tag the dcl1 gene of P. falciparum.
Dynein light chain 1 (LC1), a member of the Leucine Rich Repeat protein family, has been shown to be engaged in controlling flagellar motility in Chlamydomonas reinhardtii and Trypanosoma brucei via its interaction with the dynein-gamma heavy chain.
By screening for P. falciparum genes expressing Leucine Rich Repeat proteins a candidate dynein LC1 ortholog was identified (PfLRR7; Daher et al., 2007, Mol. Biochem. Parasitol. 155, 161-6). DLC1 of P. falciparum and P. berghei is expressed in gametocytes. In P. berghei DCL1 is specifically expressed in male gametocytes, indicating a role in flagellar motility in male gametes.
Negative attempts to tag or disrupt the dlc1 gene by reverse genetic approaches in both P. falciparum and P. berghei suggest either an essential function for blood stage development or the inaccessibility of its locus. Expression studies revealed high levels of DLC1 protein in late trophozoites and schizonts, pointing to an unexpected role of this protein in blood-stage parasites as they do not have flagella. Interactions studies and co-immunoprecipitation experiments revealed that PfDLC1 was able to bind to P. falciparum myosin A and actin 1. These observations suggest an unexpected role of PfDLC1 in the
motor complex involving actin/myosinA during blood stage development. |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | GGTACCGAAAATAAAACAAATAAATGAAATTATTGTTCG |
Additional information primer 1 | Pb1(F)(KpnI); c-terminal part of PbDLC1 |
Sequence Primer 2 | GGGCCCAACCACTTCAATTGTGAGGGAATCG |
Additional information primer 2 | Pb2(R)(ApaI); c-terminal part of PbDLC1 |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
|
top of page |