RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-374
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1206800; Gene model (P.falciparum): PF3D7_1008600; Gene product: zinc finger (CCCH type) protein, putative (S1)
Transgene
 Transgene not Plasmodium: DsRed
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr-ts)
Replacement locus: Gene model: PBANKA_1206800; Gene product: zinc finger C-x8-C-x5-C-x3-H type, putative (S1)
PhenotypeNo phenotype has been described
Last modified: 21 January 2010, 10:56
  *RMgm-374
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20045029
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherV.Y. Jacobs-Lorena; S.H. Kappe
Name Group/DepartmentDepartment of Global Health
Name InstituteSeattle Biomedical Research Institute, University of Washington
CitySeattle
CountryUSA
top of page
Name of the mutant parasite
RMgm numberRMgm-374
Principal namePbs1- clone 1
Alternative namePbs1-
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Zinc finger C-x8-C-x5-C-x3-H type, putative (protein S1) and expresses the fluorescent protein DsRed under the control of the eef1a promoter

Protein (function)
The S1 gene was identified in a subtractive hybridisation assay which identified genes that were upregulated in sporozoites ('S-genes")(Kaiser et al., 2004, Mol. Microbiol. 51, 1221-32). The protein contains three C3H1 zinc finger domains. Analysis of transcription by rtPCR shows expression in oocyst-derived and salivary gland sporozoites. No transcription was detected in blood and liver stages.

Phenotype
Phenotype analyses indicate that the protein S1 is dispensable for the complete life cycle. The lack of expression had no effect on asexual blood stage growth, gametocytes (exflagellation), oocyst and sporozoite production, and sporozoite infectivity (prepatent period).

Additional information
Because the S1 locus is dispensable for the complete life cycle, this locus can be utilized for introduction of heterologous genes into the genome (for example genes encoding fluorescent proteins).

Two gene models: PB000525.02.0 en PB300684.00.0

Other mutants
RMgm-370: A P. yoelii (17XNL, non-lethal strain) mutant lacking expression of PyS1
RMgm-373: A P. yoelii (YM, lethal strain) mutant lacking expression of PyS1
 

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1206800
Gene Model P. falciparum ortholog PF3D7_1008600
Gene productzinc finger (CCCH type) protein, putative
Gene product: Alternative nameS1
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GTGTATTATGTAGATGTATGCAATG
Additional information primer 1SP/PbS1-1
Sequence Primer 2AACGCCGTTATCACTTAATTATG
Additional information primer 2ASP/PbS1-2
Sequence Primer 3CTTATTCCCATACTACAATGC
Additional information primer 3SP/PbS1-3
Sequence Primer 4CATCAAATTCAGTAACCAATAC
Additional information primer 4ASP/PbS1-4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameDsRed
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationDsRed under the control of the P. berghei elongation factor 1 α promoter and stabilized by the P. berghei dihydrofolate reductase 3′ UTR was targeted to the S1 locus
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr-ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_1206800
Gene productzinc finger C-x8-C-x5-C-x3-H type, putative
Gene product: Alternative nameS1
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GTGTATTATGTAGATGTATGCAATG
Additional information primer 1SP/PbS1-1
Sequence Primer 2AACGCCGTTATCACTTAATTATG
Additional information primer 2ASP/PbS1-2
Sequence Primer 3CTTATTCCCATACTACAATGC
Additional information primer 3SP/PbS1-3
Sequence Primer 4CATCAAATTCAGTAACCAATAC
Additional information primer 4ASP/PbS1-4
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren