Summary

RMgm-367
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0305100; Gene model (P.falciparum): Not available; Gene product: serine repeat antigen 1 (SERA1)
PhenotypeNo phenotype has been described
Last modified: 27 April 2013, 11:51
  *RMgm-367
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20039882
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherE.D. Putrianti; O. Silvie
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-367
Principal nameser1(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of serine repeat antigen 1(SERA1; cysteine protease, putative).

Protein (function)
Plasmodium species possesses SERAs of two major groups, specified as 'cysteine-type SERAs' and 'serine-type SERAs'. Serine-type SERAs contain an active site serine residue instead of the canonical cysteine residue. The genomes of different Plasmodium species contain different numbers of SERA genes. P. falciparum possesses nine SERA protease genes whereas the P. berghei genome contains five. P. falciparum possesses six “serine-type” (SERA1 to SERA5 and SERA9) and three “cysteine-type” (SERA6 to SERA8) SERAs. In P. falciparum mutants have been generated lacking expression of SERA1, 2, 3, 4 , 7, 8 and 9 without a distinct phenotype in the blood stages (MvCoubrie J.E. et al,  2007, Infection and Immunity, 75:5565-74).

SERA genes of P. berghei are arranged in a tandem cluster that contains two serine-type SERAs (PbSERA1, -2) and three cysteine-type SERAs (PbSERA3, -4 and -5). 

Sequence homology and syntenic organisation indicate that PbSERA3, -4 (PB000352.01.0) and -5 (PB000649.01.0) are orthologs of P. falciparum SERA6, -7, -8.

P. berghei encodes two members of the SERAser subfamily, PbSERA1 and PbSERA2. Direct sequencing of cDNA from asynchronous blood stages permitted identification of the complete coding sequences (Genbank accession numbers: EU917224 and EU917225 for PbSERA1 and PbSERA2, respectively). Comparison of the P. berghei orthologs with the founding member PfSERA5 (PFB0340c) illustrates the overall amino acid sequence similarity of ~35% to the human malaria protein.

Phenotype
The phenotype analyses indicate that SERA1 does not have an essential role throughout the complete life cycle

Additional information
SERA1 and SERA2 are transcribed during formation of liver stage and blood stage merozoites. No transcription was detected in oocysts/sporozoites.
See also mutant RMgm-365 which expresses the endogenous SERA1 protein fused to the mCherry.  PbSERA1/mCherry was detected in mid and late liver stages, and localized predominantly to the parasitophorous vacuole. In contrast, SERA2/mCherry (see RMgm-366 ) became detectable only at the end of liver stage development, with an intracellular distribution in the parasite. SERA1/mCherry was not detected in merosomes, in contrast to SERA2/mCherry, which gave a strong signal associated with individual merozoites inside merosomes.
See also mutant RMgm-369: A double knock-out mutant lacking expression of SERA1 and SERA2. The normal development of this mutant throughout the life cycle indicates that SERA1 and SERA2 have no compensatory functions.
Mutants lacking both SERAs had increased levels of the cysteine-type SERA3, both at transcript and protein levels.

Other mutants
RMgm-102: A mutant lacking expression of SERA8 (PB000649.01.0; PFB0325c), a cysteine-type SERA homologue (serine repeat antigen 8, SERA-8; ECP1, egress cysteine protease 1; PbSERA5)
RMgm-271: A mutant expressing GFP under the control of the 5'-UTR of PbSERA3 (an ortholog of P. falciparum SERA6)
RMgm-272: The mutant expresses in addition to the endogenous SERA3  (the ortholog of P. falciparum SERA6) a TAP-tagged form of SERA3 under control of its own 5'-UTR and the dhfr/ts 3'-UTR
RMgm-365: A mutant expressing the endogenous SERA1 protein fused to the mCherry red fluorescent protein
RMgm-366: A mutant expressing the endogenous SERA2 protein fused to the mCherry red fluorescent protein
RMgm-368: A knock-out mutant lacking expression of SERA2
RMgm-369: A double knock-out mutant lacking expression of SERA1 and SERA2


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0305100
Gene Model P. falciparum ortholog Not available
Gene productserine repeat antigen 1
Gene product: Alternative nameSERA1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, SacII
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCCCCATACCATCACCCCCTTCAAC
Additional information primer 1SERA1_for1 (KpnI); 5'target
Sequence Primer 2GCCCAAGCTTCCAGTTCTCCCGTACCTTCAACCACC
Additional information primer 2SERA1_revII (HindIII); 5'target
Sequence Primer 3CGCGGATCCGTTGGCAAAGGGGAATATATCGTATCA
Additional information primer 3SERA1_forIII (BamHI); 3'target
Sequence Primer 4TCCCCGCGGCGAATTTTTACAACTTAAACCATAGTGCAC
Additional information primer 4SERA1_revIV (SacII); 3'target
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6