SummaryRMgm-346
|
Successful modification | The parasite was generated by the genetic modification | ||||||||||||||||||||||||
The mutant contains the following genetic modification(s) | Gene disruption, Introduction of a transgene | ||||||||||||||||||||||||
Reference (PubMed-PMID number) | Not published (yet) | ||||||||||||||||||||||||
MR4 number | |||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Parent parasite used to introduce the genetic modification | |||||||||||||||||||||||||
Rodent Malaria Parasite | P. berghei | ||||||||||||||||||||||||
Parent strain/line | P. berghei ANKA | ||||||||||||||||||||||||
Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) | ||||||||||||||||||||||||
Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190). | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
The mutant parasite was generated by | |||||||||||||||||||||||||
Name PI/Researcher | B. Franke-Fayard; C.J. Janse | ||||||||||||||||||||||||
Name Group/Department | Leiden Malaria Research Group | ||||||||||||||||||||||||
Name Institute | Leiden University Medical Center | ||||||||||||||||||||||||
City | Leiden | ||||||||||||||||||||||||
Country | The Netherlands | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Name of the mutant parasite | |||||||||||||||||||||||||
RMgm number | RMgm-346 | ||||||||||||||||||||||||
Principal name | 764acl1 | ||||||||||||||||||||||||
Alternative name | |||||||||||||||||||||||||
Standardized name | |||||||||||||||||||||||||
Is the mutant parasite cloned after genetic modification | Yes | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Phenotype | |||||||||||||||||||||||||
Asexual blood stage | Not different from wild type | ||||||||||||||||||||||||
Gametocyte/Gamete | Male gametes are strongly affected in their fertility, resulting in nearly complete inhibition of ookinete formation in vitro (>0.99%); Motile males fail to attach to and penetrate female gametes. Mutant female gametes are fertile as shown by cross-fertilization with wild type male gametes. Mutant parasites produce low numbers of ookinetes in vivo (Anopheles stephensi). See also 'Additional remarks phenotype'. | ||||||||||||||||||||||||
Fertilization and ookinete | Male gametes are strongly affected in their fertility, resulting in nearly complete inhibition of ookinete formation in vitro (>0.99%); Motile males fail to attach to and penetrate female gametes. Mutant female gametes are fertile as shown by cross-fertilization with wild type male gametes. Mutant parasites produce low numbers of ookinetes in vivo (Anopheles stephensi). See also 'Additional remarks phenotype'. | ||||||||||||||||||||||||
Oocyst | Not different from wild type | ||||||||||||||||||||||||
Sporozoite | Not different from wild type | ||||||||||||||||||||||||
Liver stage | Not different from wild type | ||||||||||||||||||||||||
Additional remarks phenotype | Mutant/mutation Mutants lacking expression of P48/45 are frequently used in cross-fertilization studies in which the fertile females are used to test the fertility of males of other mutants (Khan et al., Cell (2005) 121, 675-87; Raine, J.D. et al., PLoS Pathog (2007) 3,e30).
Other mutants |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1359600 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1346700 | ||||||||||||||||||||||||
Gene product | 6-cysteine protein | transmission blocking target antigen precursor | ||||||||||||||||||||||||
Gene product: Alternative name | P48/45 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
GGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGGATCCGAAGGCATATATAAGCAT
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | 5'UTR and 550bp of coding region intact | ||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |
top of page | |||||||||||||||||||
Type and details of transgene | |||||||||||||||||||
Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
Transgene name | GFP (gfp-mu3) | ||||||||||||||||||
top of page | |||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||
Inducable system used | No | ||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||
Type of plasmid/construct | Plasmid double cross-over | ||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||
Plasmid/construct sequence |
AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
| ||||||||||||||||||
Restriction sites to linearize plasmid | KspI (SacII) | ||||||||||||||||||
Selectable marker used to select the mutant parasite | gfp (FACS) | ||||||||||||||||||
Promoter of the selectable marker | No | ||||||||||||||||||
Selection (positive) procedure | FACS (flowsorting) | ||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||
Additional remarks genetic modification | The GFP gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration. | ||||||||||||||||||
Additional remarks selection procedure | This reporter mutant expressing GFP does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence. | ||||||||||||||||||
top of page | |||||||||||||||||||
Other details transgene | |||||||||||||||||||
top of page | |||||||||||||||||||
Promoter | |||||||||||||||||||
Gene Model of Parasite | PBANKA_1133300 | ||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1357100 | ||||||||||||||||||
Gene product | elongation factor 1-alpha | ||||||||||||||||||
Gene product: Alternative name | eef1a | ||||||||||||||||||
| |||||||||||||||||||
top of page | |||||||||||||||||||
3'-UTR | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
Gene product: Alternative name | dhfr-ts | ||||||||||||||||||
| |||||||||||||||||||
Insertion/Replacement locus | |||||||||||||||||||
Replacement / Insertion | Replacement locus | ||||||||||||||||||
Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
Gene product | 6-cysteine protein | ||||||||||||||||||
Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
top of page |