RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-344
Malaria parasiteP. berghei
Genotype
Transgene
Transgene not Plasmodium: A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Promoter: Gene model: PBANKA_0915000; Gene model (P.falciparum): PF3D7_1133400; Gene product: apical membrane antigen 1
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Transgene
Transgene not Plasmodium: A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr-ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Asexual bloodstage;
Last modified: 24 January 2010, 13:11
  *RMgm-344
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene, Introduction of a transgene
Reference (PubMed-PMID number) Not published (yet)
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherB. Franke-Fayard; C.J. Janse
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-344
Principal name1052cl1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageGFP-Luciferase expression in all blood stages
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses GFP-luciferase. It contains two copies of the gfp-luciferase gene that are integrated into the 230p locus. One copy is  under the control of the schizont-specific ama-1 promoter and the second copy under the control of the constitutive eef1a promoter. This reporter mutant does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.

Phenotype
The mutant expresses GFP-luciferase in all blood stages. Other phenotypic features such as growth characteristics and gametocyte production have not yet been analysed in detail. GFP-luciferase expression in other life cycle stages has not been analysed. Based on the GFP-luciferase expression pattern of an other reporter line that expresses this protein under the control of the eef1a promoter (RMgm-29) it can be expected that all life cycle stages express GFP-luciferase.

One advantage of expression of the additional copy of gfp-luciferase under the ama-1 promoter is that it might enhance detection of the young ring forms and therefore results in improved quantitative analysis of blood stages by FACS analysis, intravital-imaging and luciferase assays (Franke-Fayard et al., 2008, Int. J. Parasitol. 38, 1651-62).

Additional information

Other mutants
See RMgm-28,RMgm-29,RMgm-30,RMgm-32 for reporter parasite lines that express one copy of GFP-luciferase either under the control of the eef1a promoter or under the control of the ama-1 promoter. Lines RMgm-28 and RMgm-30 contain drug-selectable markers whereas lines RMgm-29 and RMgm-32 are drug-selectable marker free.

 


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameA fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACC
GATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTT
CTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGC
TCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGA
CGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGC
ATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATA
CGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACT
TTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATG
TATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGT
ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCT
GTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCA
CGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCC
GAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCC
CGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTG
GTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTA
TGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATC
GGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT
GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATG
CCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCT
TCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGC
TCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCT
CGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTAC
ACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCC
TCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGAT
TTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATG
ACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATC
AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAA
CCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAG
GTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTA
GGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTA
CCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG
TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTG
GAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACG
CTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAG
CGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGC
CACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA
AACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATG
TTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCT
GATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAA
GAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGG
CACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAG
CTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
ATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTT
CCGCGGGTATATGGTAAAGAACCTACTAACACAATAAAATATTTAAATAATGTATTTCCT
ATAAATAAATTTACAGATTTATTTTTTAATACAAAAGATATAGATATACCAGAAATAAAT
GATCAGTTTAAAGGTTTTAAATTCTTTATGACATCATTTATAAATCATGGATCATATCCA
CTAACAATAGAATGTGGTGTAACAAATGGTGGAACTAGTTATAAAAGAGCAATTATTTTA
TTGCATGTTCGAACTGATTTAAAAGATAGACCAGTTTCATTTTGTGATTTTCGAAAAGGA
GAATTATATAATTATTTGAATGCTTATACTGAAGGGGATGTATGCATAATAATTTCCAAA
TCAAATACAAGTTTTGGTTTTAGATGCCCAGTAAATACAAAAAAAATGCCAAAAAATTGT
TTTACGCAAGTATATGAAAAAGGGTATCTAAATGACGCCAATAAAATTAATACTAAAAAT
GTTATTAACTATTCATTTGAAAATCCAGAATATGCGCTAGCTGGTTYTAATTATACATTA
ACAAAATCGTATCAATTTGAATGTCATTGTGTAGATAAAGAAACAGAACAAATTGTAAAA
ACGGTTTTAGTCAAATATGTAAATGAAGATGAAATATATGATTATAATGATTTTCCAATG
GTGAATCACAAACCTATTATTGCACATCCAAATAAAACACATCAAGCTTGCATGCCTGCA
GGAATTCGATATCGAATTCCCATGGAACCAAAATAACATATTAATGAATTTTCTTTTATT
GTGAAAATGTTCTTATTTGTTTTAAAAAATCAAAGTAAATTTAATTCCTTTAATTGTGCT
AAATATTGTGTTTGTATAACTATAATGACATTTCCTATGCTTTTTTAATATTATATATAA
TTTTTTGTGTTTTTTCAAAAAAAACGTGTATTTGTTTTTATTTGAGTGTACAATTTGCAT
AGTGAGTTTAAAGTGTTTGAAAATTATTTAATTTATAATTTTCATAAAACGTTTAATCAT
TTATCAAAATTGCGGTTGCAATATAGACAGAAAATATTAACTTAATTTTCATTGTTTTGT
AAAACATTTTCATTATTTTTTTTAACAAAATTAAAGTAAATGAGATGGTAAATTATTTTA
ATTATAACCATTTGTTTAATTTTTTTTATTTTATTACTATTATTTTTTTTCTTTTGTGCT
GCGCAATTAAAAAGAGAATTAAGGGTGCACCAATATATTTAAGCAATCTTTTGCGACACA
CAAGAAAAAATATAACATCAACATATTTAAAATAATGGAAATTTTTTAATAATTTATTCT
ATATATATTTAATATATGTAAAAAAACTAATATTGTAATATAATTAAATAAAACTTGAAA
TTGATATAATATGTATATATATTGCATGTTTAGCTTTAAATAATATTTAAGTATTGATTT
TCTTTACACACAAAAACATTTGCCTTTTTATGTGAGGATTATTGTTTCTTTATTTATATT
GCTATGAATTTATTCTTAGTATAAATTTATTTTTTTTCGGCTTTGAAAATAATTTTATAT
ATATAAAAAGAAAAAATATGGAAAATAAAATTCATAAATCATATTTGACACATTTCAATT
TTTTTTTCTTATTTCACAGCTAGCCATATAATAATATATATGTGTCTATGGGTTCAAATA
GCTTAATTTCAATGTGCGTGATTTTTTTTTATAAAAAAACTAATTTTATGTTTGGTTATG
CATGCAACTGTTATAAAATAAAAATTGTAAAATTTGTTTTTTTGTACACATATTTGTACT
TTTTTTAATGCACATGAAAAAAGAAAGGAAAAAAAAGGGGGAAAAAAAAGGAAAAAAAAA
GGGAAAAAAGGGAAAAAACGTACATCTACGCATTGTTATTTAGCAATAAAATAGAGAACA
AATCTATAAATATATAATGTGTACAACAAATTAATTTAATTTATATTTTTACTGTAATTT
CATAATAATTTTCATTTTTACATTTTAATGTTTTTTTAATTGGAATATAATTCAAAATGA
TTTTGACACATTTTACTTATAGAAGAAGGCTATATAATTATATAAGTGTGTATATATAAG
TATTGTATGGTAATTGTTTTATAAATTAAATTTTTAAAAAACATTATTCTATTTTATAAT
TTGTAAATTAAAAATATTAATAAAATAAAACGATATAAAAGGATCCATGAGTAAAGGAGA
AGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCA
CAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAA
ATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGG
TTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAA
GAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAA
CTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTT
AAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTA
TAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTT
CAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAA
TACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATC
TGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAAC
AGCTGCTGGGATTACACATGGCATGGATGAACTATACAAAGGGATCCTGGCTAGCCAGTC
GACCTGCAGGCATGCAAGCTTGCGGCCGATCCAAATGGAAGACGCCAAAAACATAAAGAA
AGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGC
TATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGT
GAACATCACGTACGCGGAATACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACG
ATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTT
TATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTA
TAATGAACGTGAATTGCTCAACAGTATGAACATTTCGCAGCCTACCGTAGTGTTTGTTTC
CAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAATTACCAATAATCCAGAAAAT
TATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCAC
ATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTACCAGAGTCCTTTGATCGTGA
CAAAACAATTGCACTGATAATGAATTCCTCTGGATCTACTGGGTTACCTAAGGGTGTGGC
CCTTCCGCATAGAACTGCCTGCGTCAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAA
TCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAAT
GTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGA
AGAAGAGCTGTTTTTACGATCCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTACC
AACCCTATTTTCATTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTT
ACACGAAATTGCTTCTGGGGGCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGGTTGCAAA
ACGCTTCCATCTTCCAGGGATACGACAAGGATATGGGCTCACTGAGACTACATCAGCTAT
TCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTT
TGAAGCGAAGGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAGAGAGGCGA
ATTATGTGTCAGAGGACCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAA
CGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGA
CGAACACTTCTTCATAGTTGACCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAGGT
GGCCCCCGCTGAATTGGAATCGATATTGTTACAACACCCCAACATCTTCGACGCGGGCGT
GGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCA
CGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGC
GAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAA
ACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGC
CGTGTAATTCTAGAAGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTATT
TATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGT
AAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACAT
AAAATGGCTAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGACCA
TATTAAAAATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTATT
ATTATTATTATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGT
TGGACTTGATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAA
AAATTAAAAAAAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCGGGTACCGAG
CTCTTTATGCTTAAGTTTACAATTTAATATTCATACTTTAAGTATTTTTTGTAGTATCCT
AGATATTGTGCTTTAAATGCTCACCCCTCAAAGCACCAGTAATATTTTCATCCACTGAAA
TACCATTAAATTTTCAAAAAAATACTATGCATATAATGTTATACATATAAACATAAAACG
CCATGTAAATCAAAAAATATATAAAAATATGTATAAAAATAAATATGCACTAAATATAAG
CTAATTATGCATAAAAATTAAAGTGCCCTTTATTAACTAGTCGTAATTATTTATATTTCT
ATGTTATAAAAAAATCCTCATATAATAATATAATTAATATATGTAATGTTTTTTTTATTT
TATAATTTTAATATAAAATAATATGTAAATTAATTCAAAAAATAAATATAATTGTTGTGA
AACAAAAAACGTAATTTTTTCATTTGCCTTCAAAATTTAAATTTATTTTAATATTTCCTA
AAATATATATACTTTGTGTATAAATATATAAAAATATATATTTGCTTATAAATAAATAAA
AAATTTTATAAAACATAGGGGGATCTATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTG
TCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAG
AGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAA
AACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTG
CGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTT
ATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAG
TCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAG
AAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACA
TCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTG
AAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCC
CTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCA
ACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATG
GCATGGATGAACTATACAAAGGGATCCTGGCTAGCCAGTCGACCTGCAGGCATGCAAGCT
TGCGGCCGATCCAAATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATC
CGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGG
TTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGAACATCACGTACGCGGAAT
ACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATC
ACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGT
TATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCA
ACAGTATGAACATTTCGCAGCCTACCGTAGTGTTTGTTTCCAAAAAGGGGTTGCAAAAAA
TTTTGAACGTGCAAAAAAAATTACCAATAATCCAGAAAATTATTATCATGGATTCTAAAA
CGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTT
TTAATGAATACGATTTTGTACCAGAGTCCTTTGATCGTGACAAAACAATTGCACTGATAA
TGAATTCCTCTGGATCTACTGGGTTACCTAAGGGTGTGGCCCTTCCGCATAGAACTGCCT
GCGTCAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTG
CGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAATGTTTACTACACTCGGATATT
TGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGCTGTTTTTACGAT
CCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTACCAACCCTATTTTCATTCTTCG
CCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAATTGCTTCTGGGG
GCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGGTTGCAAAACGCTTCCATCTTCCAGGGA
TACGACAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTACACCCGAGGGGG
ATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTGTGGATC
TGGATACCGGGAAAACGCTGGGCGTTAATCAGAGAGGCGAATTATGTGTCAGAGGACCTA
TGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATG
GATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGACGAACACTTCTTCATAGTTG
ACCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAGGTGGCCCCCGCTGAATTGGAAT
CGATATTGTTACAACACCCCAACATCTTCGACGCGGGCGTGGCAGGTCTTCCCGACGATG
ACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGACGGAAA
AAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTGCGCGGAGGAG
TTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCA
GAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAATTCTAGAAGATCC
CGTTTTTCTTACTTATATATTTATACCAATTGATTGTATTTATAACTGTAAAAATGTGTA
TGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGTAAATAGCTAAAATTATGAAC
ATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACATAAAATGGCTAGTATGAATAG
CCATATTTTATATAAATTAAATCCTATGAATTTATGACCATATTAAAAATTTAGATATTT
ATGGAACATAATATGTTTGAAACAATAAGACAAAATTATTATTATTATTATTATTTTTAC
TGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGTTGGACTTGATTTTTAAAATG
TTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAAAAATTAAAAAAAAACATATA
AACACAAATGATGTTTTTTCCTTCAATTTCGGGTACCGAGCTCGAATTCTCTTGAGCCCG
TTAATGAAATAGATACAATTCATTCATGTTATATACATCTAGAACATAATCTGAATATGG
TTCAAGTTAAATGTCCAAAAATTATAAAAAGTGATGATATTTTTGATGGTAATACCATAA
TAGACACCAAGGTAACATCACGAAGTAGTCAACAAAATAATTTTTATTTAGAAAATACAG
ATGTTGAACCAGAAGAAATAGAGAAATATAAAAATATAGAATACATACCAGAAAACGATG
AAGTAATGCATCTAGACAAAAAAGAAAAGCTAGATGATATATTACCAGGTGTTATCATAT
TAGATAAAAATAAAATGTTCAAAGAAAAAGGACATTTCACTTTTGTTACTCCATTAATTG
TAGAAAAGGTATTAATATTAAAAATATATTGTGATAATACTAAAACAATAATTAATAATA
TGAAAGGGAAAAAAGGTATTACAGTAATAAGGATTTCTCAAAATACAACAAAAAATAAAT
TTTATGGATGTGACTTTTCAGGTAATTCTAAAAAAACATTTTACTATTCCAATGTTTATG
ATTTAGAAAAAAAAAATGAGTTTTGTGAAATAGAATTAAAAGAAAATATAGTAGTTAGCT
TAAATTGTCCAACTGGTAAAATTAATCCAAAAAATTGTTTTAGAAATGTATATATAAAAA
GTAATATGAATGAACAAACAACCGAAAATATAGAAAATATATTTAACGAAATAAAAGTTA
TAGATGCAGATTATTTTATAAATAATTCATCAACCTTTTTGATGATTTCCAAAATTACAA
AAAAAGAGTTTGATTTTTATTGTACATGTGAAGATTATAAAACCAAAAATATAGGAACAA
TATATATTAAAAATTATGAATATCTAGATTCAAAACCTAAATATAAAAATAAACAAATTT
CCTATATAGATGTAGTTCCATACCCGCGGGGAAAGGGCG
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markerNo
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe two copies of the GFP-Luciferase gene that are under control of two different promoters have been inserted into the 230p locus (PB000214.00.0) by double cross-over integration.
Additional remarks selection procedureThis reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0915000
Gene Model P. falciparum ortholog PF3D7_1133400
Gene productapical membrane antigen 1
Gene product: Alternative name
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameA fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACC
GATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTT
CTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGC
TCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGA
CGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGC
ATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATA
CGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACT
TTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATG
TATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGT
ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCT
GTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCA
CGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCC
GAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCC
CGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTG
GTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTA
TGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATC
GGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT
GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATG
CCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCT
TCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGC
TCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCT
CGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTAC
ACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCC
TCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGAT
TTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATG
ACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATC
AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAA
CCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAG
GTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTA
GGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTA
CCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG
TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTG
GAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACG
CTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAG
CGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGC
CACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA
AACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATG
TTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCT
GATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAA
GAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGG
CACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAG
CTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
ATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTT
CCGCGGGTATATGGTAAAGAACCTACTAACACAATAAAATATTTAAATAATGTATTTCCT
ATAAATAAATTTACAGATTTATTTTTTAATACAAAAGATATAGATATACCAGAAATAAAT
GATCAGTTTAAAGGTTTTAAATTCTTTATGACATCATTTATAAATCATGGATCATATCCA
CTAACAATAGAATGTGGTGTAACAAATGGTGGAACTAGTTATAAAAGAGCAATTATTTTA
TTGCATGTTCGAACTGATTTAAAAGATAGACCAGTTTCATTTTGTGATTTTCGAAAAGGA
GAATTATATAATTATTTGAATGCTTATACTGAAGGGGATGTATGCATAATAATTTCCAAA
TCAAATACAAGTTTTGGTTTTAGATGCCCAGTAAATACAAAAAAAATGCCAAAAAATTGT
TTTACGCAAGTATATGAAAAAGGGTATCTAAATGACGCCAATAAAATTAATACTAAAAAT
GTTATTAACTATTCATTTGAAAATCCAGAATATGCGCTAGCTGGTTYTAATTATACATTA
ACAAAATCGTATCAATTTGAATGTCATTGTGTAGATAAAGAAACAGAACAAATTGTAAAA
ACGGTTTTAGTCAAATATGTAAATGAAGATGAAATATATGATTATAATGATTTTCCAATG
GTGAATCACAAACCTATTATTGCACATCCAAATAAAACACATCAAGCTTGCATGCCTGCA
GGAATTCGATATCGAATTCCCATGGAACCAAAATAACATATTAATGAATTTTCTTTTATT
GTGAAAATGTTCTTATTTGTTTTAAAAAATCAAAGTAAATTTAATTCCTTTAATTGTGCT
AAATATTGTGTTTGTATAACTATAATGACATTTCCTATGCTTTTTTAATATTATATATAA
TTTTTTGTGTTTTTTCAAAAAAAACGTGTATTTGTTTTTATTTGAGTGTACAATTTGCAT
AGTGAGTTTAAAGTGTTTGAAAATTATTTAATTTATAATTTTCATAAAACGTTTAATCAT
TTATCAAAATTGCGGTTGCAATATAGACAGAAAATATTAACTTAATTTTCATTGTTTTGT
AAAACATTTTCATTATTTTTTTTAACAAAATTAAAGTAAATGAGATGGTAAATTATTTTA
ATTATAACCATTTGTTTAATTTTTTTTATTTTATTACTATTATTTTTTTTCTTTTGTGCT
GCGCAATTAAAAAGAGAATTAAGGGTGCACCAATATATTTAAGCAATCTTTTGCGACACA
CAAGAAAAAATATAACATCAACATATTTAAAATAATGGAAATTTTTTAATAATTTATTCT
ATATATATTTAATATATGTAAAAAAACTAATATTGTAATATAATTAAATAAAACTTGAAA
TTGATATAATATGTATATATATTGCATGTTTAGCTTTAAATAATATTTAAGTATTGATTT
TCTTTACACACAAAAACATTTGCCTTTTTATGTGAGGATTATTGTTTCTTTATTTATATT
GCTATGAATTTATTCTTAGTATAAATTTATTTTTTTTCGGCTTTGAAAATAATTTTATAT
ATATAAAAAGAAAAAATATGGAAAATAAAATTCATAAATCATATTTGACACATTTCAATT
TTTTTTTCTTATTTCACAGCTAGCCATATAATAATATATATGTGTCTATGGGTTCAAATA
GCTTAATTTCAATGTGCGTGATTTTTTTTTATAAAAAAACTAATTTTATGTTTGGTTATG
CATGCAACTGTTATAAAATAAAAATTGTAAAATTTGTTTTTTTGTACACATATTTGTACT
TTTTTTAATGCACATGAAAAAAGAAAGGAAAAAAAAGGGGGAAAAAAAAGGAAAAAAAAA
GGGAAAAAAGGGAAAAAACGTACATCTACGCATTGTTATTTAGCAATAAAATAGAGAACA
AATCTATAAATATATAATGTGTACAACAAATTAATTTAATTTATATTTTTACTGTAATTT
CATAATAATTTTCATTTTTACATTTTAATGTTTTTTTAATTGGAATATAATTCAAAATGA
TTTTGACACATTTTACTTATAGAAGAAGGCTATATAATTATATAAGTGTGTATATATAAG
TATTGTATGGTAATTGTTTTATAAATTAAATTTTTAAAAAACATTATTCTATTTTATAAT
TTGTAAATTAAAAATATTAATAAAATAAAACGATATAAAAGGATCCATGAGTAAAGGAGA
AGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCA
CAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAA
ATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGG
TTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAA
GAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAA
CTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTT
AAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTA
TAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTT
CAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAA
TACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATC
TGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAAC
AGCTGCTGGGATTACACATGGCATGGATGAACTATACAAAGGGATCCTGGCTAGCCAGTC
GACCTGCAGGCATGCAAGCTTGCGGCCGATCCAAATGGAAGACGCCAAAAACATAAAGAA
AGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGC
TATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGT
GAACATCACGTACGCGGAATACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACG
ATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTT
TATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTA
TAATGAACGTGAATTGCTCAACAGTATGAACATTTCGCAGCCTACCGTAGTGTTTGTTTC
CAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAATTACCAATAATCCAGAAAAT
TATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCAC
ATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTACCAGAGTCCTTTGATCGTGA
CAAAACAATTGCACTGATAATGAATTCCTCTGGATCTACTGGGTTACCTAAGGGTGTGGC
CCTTCCGCATAGAACTGCCTGCGTCAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAA
TCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAAT
GTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGA
AGAAGAGCTGTTTTTACGATCCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTACC
AACCCTATTTTCATTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTT
ACACGAAATTGCTTCTGGGGGCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGGTTGCAAA
ACGCTTCCATCTTCCAGGGATACGACAAGGATATGGGCTCACTGAGACTACATCAGCTAT
TCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTT
TGAAGCGAAGGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAGAGAGGCGA
ATTATGTGTCAGAGGACCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAA
CGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGA
CGAACACTTCTTCATAGTTGACCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAGGT
GGCCCCCGCTGAATTGGAATCGATATTGTTACAACACCCCAACATCTTCGACGCGGGCGT
GGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCA
CGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGC
GAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAA
ACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGC
CGTGTAATTCTAGAAGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTATT
TATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGT
AAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACAT
AAAATGGCTAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGACCA
TATTAAAAATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTATT
ATTATTATTATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGT
TGGACTTGATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAA
AAATTAAAAAAAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCGGGTACCGAG
CTCTTTATGCTTAAGTTTACAATTTAATATTCATACTTTAAGTATTTTTTGTAGTATCCT
AGATATTGTGCTTTAAATGCTCACCCCTCAAAGCACCAGTAATATTTTCATCCACTGAAA
TACCATTAAATTTTCAAAAAAATACTATGCATATAATGTTATACATATAAACATAAAACG
CCATGTAAATCAAAAAATATATAAAAATATGTATAAAAATAAATATGCACTAAATATAAG
CTAATTATGCATAAAAATTAAAGTGCCCTTTATTAACTAGTCGTAATTATTTATATTTCT
ATGTTATAAAAAAATCCTCATATAATAATATAATTAATATATGTAATGTTTTTTTTATTT
TATAATTTTAATATAAAATAATATGTAAATTAATTCAAAAAATAAATATAATTGTTGTGA
AACAAAAAACGTAATTTTTTCATTTGCCTTCAAAATTTAAATTTATTTTAATATTTCCTA
AAATATATATACTTTGTGTATAAATATATAAAAATATATATTTGCTTATAAATAAATAAA
AAATTTTATAAAACATAGGGGGATCTATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTG
TCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAG
AGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAA
AACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTG
CGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTT
ATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAG
TCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAG
AAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACA
TCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTG
AAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCC
CTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCA
ACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATG
GCATGGATGAACTATACAAAGGGATCCTGGCTAGCCAGTCGACCTGCAGGCATGCAAGCT
TGCGGCCGATCCAAATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATC
CGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGG
TTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGAACATCACGTACGCGGAAT
ACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATC
ACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGT
TATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCA
ACAGTATGAACATTTCGCAGCCTACCGTAGTGTTTGTTTCCAAAAAGGGGTTGCAAAAAA
TTTTGAACGTGCAAAAAAAATTACCAATAATCCAGAAAATTATTATCATGGATTCTAAAA
CGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTT
TTAATGAATACGATTTTGTACCAGAGTCCTTTGATCGTGACAAAACAATTGCACTGATAA
TGAATTCCTCTGGATCTACTGGGTTACCTAAGGGTGTGGCCCTTCCGCATAGAACTGCCT
GCGTCAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTG
CGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAATGTTTACTACACTCGGATATT
TGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGCTGTTTTTACGAT
CCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTACCAACCCTATTTTCATTCTTCG
CCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAATTGCTTCTGGGG
GCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGGTTGCAAAACGCTTCCATCTTCCAGGGA
TACGACAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTACACCCGAGGGGG
ATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTGTGGATC
TGGATACCGGGAAAACGCTGGGCGTTAATCAGAGAGGCGAATTATGTGTCAGAGGACCTA
TGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATG
GATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGACGAACACTTCTTCATAGTTG
ACCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAGGTGGCCCCCGCTGAATTGGAAT
CGATATTGTTACAACACCCCAACATCTTCGACGCGGGCGTGGCAGGTCTTCCCGACGATG
ACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGACGGAAA
AAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTGCGCGGAGGAG
TTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCA
GAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAATTCTAGAAGATCC
CGTTTTTCTTACTTATATATTTATACCAATTGATTGTATTTATAACTGTAAAAATGTGTA
TGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGTAAATAGCTAAAATTATGAAC
ATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACATAAAATGGCTAGTATGAATAG
CCATATTTTATATAAATTAAATCCTATGAATTTATGACCATATTAAAAATTTAGATATTT
ATGGAACATAATATGTTTGAAACAATAAGACAAAATTATTATTATTATTATTATTTTTAC
TGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGTTGGACTTGATTTTTAAAATG
TTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAAAAATTAAAAAAAAACATATA
AACACAAATGATGTTTTTTCCTTCAATTTCGGGTACCGAGCTCGAATTCTCTTGAGCCCG
TTAATGAAATAGATACAATTCATTCATGTTATATACATCTAGAACATAATCTGAATATGG
TTCAAGTTAAATGTCCAAAAATTATAAAAAGTGATGATATTTTTGATGGTAATACCATAA
TAGACACCAAGGTAACATCACGAAGTAGTCAACAAAATAATTTTTATTTAGAAAATACAG
ATGTTGAACCAGAAGAAATAGAGAAATATAAAAATATAGAATACATACCAGAAAACGATG
AAGTAATGCATCTAGACAAAAAAGAAAAGCTAGATGATATATTACCAGGTGTTATCATAT
TAGATAAAAATAAAATGTTCAAAGAAAAAGGACATTTCACTTTTGTTACTCCATTAATTG
TAGAAAAGGTATTAATATTAAAAATATATTGTGATAATACTAAAACAATAATTAATAATA
TGAAAGGGAAAAAAGGTATTACAGTAATAAGGATTTCTCAAAATACAACAAAAAATAAAT
TTTATGGATGTGACTTTTCAGGTAATTCTAAAAAAACATTTTACTATTCCAATGTTTATG
ATTTAGAAAAAAAAAATGAGTTTTGTGAAATAGAATTAAAAGAAAATATAGTAGTTAGCT
TAAATTGTCCAACTGGTAAAATTAATCCAAAAAATTGTTTTAGAAATGTATATATAAAAA
GTAATATGAATGAACAAACAACCGAAAATATAGAAAATATATTTAACGAAATAAAAGTTA
TAGATGCAGATTATTTTATAAATAATTCATCAACCTTTTTGATGATTTCCAAAATTACAA
AAAAAGAGTTTGATTTTTATTGTACATGTGAAGATTATAAAACCAAAAATATAGGAACAA
TATATATTAAAAATTATGAATATCTAGATTCAAAACCTAAATATAAAAATAAACAAATTT
CCTATATAGATGTAGTTCCATACCCGCGGGGAAAGGGCG
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markerNo
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration.
Additional remarks selection procedureThis reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr-ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4