SummaryRMgm-335
|
Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
The following genetic modifications were attempted | Gene disruption |
Number of attempts to introduce the genetic modification | 2 |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 20478340 |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 2.34 |
Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943). |
top of page | |
Attempts to generate the mutant parasite were performed by | |
Name PI/Researcher | S. Déchamps; K. Wengelnik; H.J. Vial; L. Gannoun-Zaki |
Name Group/Department | Dynamique des Interactions Membranaires Normales et Pathologiques |
Name Institute | Université Montpellier |
City | Montpellier |
Country | France |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1415100 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1316600 | ||||||||||||||||||||||||
Gene product | choline-phosphate cytidylyltransferase | ||||||||||||||||||||||||
Gene product: Alternative name | CCT | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid single cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | Plasmid pDR-ΔCCT was constructed by amplifying an 1151 bp fragment (nucleotides 598-1748) of the genomic Pbcct using primers p11/p12 and inserted into pDR009. As a consequence of the homologous recombination event, the endogenous gene was truncated and non-functional (lacking the c-terminus), while the introduced sequences were not translated into functional enzymes due to the absence of the promoter and the translation initiation codon. In addition, two unsuccessful attempts are described to disrupt the gene by a double cross-over recombination approach described by Ecker et al. (Mol. Biochem. Parasitol. 2006, 145, 265-8). This strategy is used to replace the endogenous gene with the selectable marker (human dhfr) using a two-step PCR approach leading to a double cross-over recombination event. The PCR fragments for double homologous recombination were each transfected in two independent experiments (PCR primers used: p40 (cct_i F) CCATATTTTATATCTTCATTGTTTGG; p41 (cct_ii R) GCTGGGCTGCAGAGGCCTGTTAACCATATATGTGCATAAACAAATGCTGC; p42 (cct_iii F) CGATGGGTACCCTCGAGGCTAGCGACCATAAGGCTAATGGGGAAGGG; p43 (cct_iv R) CCAAGCTTCCATGCTTATTTTCGCTTATCG). The unsuccessful attempts to disrupt the cct gene suggest that this gene is essential for blood stage development (see also below). Tagging of the gene with gfp was successful (see RMgm-339) Phosphatidylcholine (PC) and phosphatidylethanolamine (PE) are the major phospholipids of cellular membranes. These two phospholipids represent 40–50% and 35–40% of the total phospholipids in Plasmodium. Biosynthesis of PC and PE has been well studied revealing the presence of multiple pathways: de novo CDPcholine (CDP-Cho) and CDP-ethanolamine (CDP-Etn), also called the Kennedy pathways, and the CDP-diacylglycerol (CDP-DAG) dependent pathway. The Kennedy pathways initiate from exogenous choline and ethanolamine involving choline kinase (CK; EC 2.7.1.32; PF14_0020; PBANKA_104010) and ethanolamine kinase (EK; EC 2.7.1.82), followed by the choline-phosphate cytidylyltransferase (CCT; EC 2.7.7.15; MAL13P1.86; PBANKA_141510) and ethanolamine-phosphate cytidylyltransferase (ECT; EC 2.7.7.14; PF13_0253; PBANKA_136050) that catalyse the formation of CDP-choline and CDP-ethanolamine. Finally, in Plasmodium, PC and PE are apparently synthesized by a common choline/ethanolamine-phosphotransferase (CEPT; 2.7.8.2 (CPT and 2.7.8.1 (EPT); PFF1375c; PBANKA_112700). The de novo Kennedy pathways initiate with the phosphorylation of the polar heads by CK and EK. The phosphorylated polar heads are subsequently coupled to CTP, by CCT and ECT thus generating CDP-Cho and CDP-Etn, respectively. Biochemical studies in P. berghei strongly support the existence of both the CDP-Cho and the CDP-Etn pathways for the synthesis of PC and PE. An additional route termed serine decarboxylation-phosphoethanolamine methylation (SDPM) pathway has been identified in P. falciparum. In this plant-like pathway that connects different routes, the polar head groups of PE and PC are synthesized from serine that is either directly imported from the host or obtained through degradation of host cell haemoglobin. However, phosphoethanolamine N80 methyltransferase (PMT) activity is absent from P. berghei and an ortholog to the P. falciparum pmt gene (MAL13P1.214) could not be identified in the genome of P. berghei and other rodent malaria parasites. Two different approaches were used to attempt to knockout the cept (see RMgm-336), cct (see RMgm-335), ect (see RMgm-337) and ck (see RMgm-334) genes in P. berghei. The first approach was based on double homologous recombination using PCR amplicons to replace the endogenous genes by a selectable marker cassette. The second consisted of gene disruption by single cross-over event leading to duplication of the integrated sequence and the generation of two non-functional copies of the target gene. P. berghei transfections were performed in two independent trials for the double recombination approach and in two independent trials for the gene disruption strategy. In order to demonstrate that the failure to generate disrupted cept, cct, ect and ck loci was not due to the inaccessibility of these loci to homologous recombination, simultaneously to the gene disruption experiments, transfection experiments were performed with constructs carrying GFP-tagged genes: cept-gfp (see RMgm-340), cct-gfp (see RMgm-339), ect-gfp (see RMgm-341) and ck-gfp (see RMgm-338). For all genes, integration in their respective locus was successful generating a full-length version of the gene fused to GFP. These results showed that all these loci were accessible for homologous recombination, but deletion or disruption of the coding sequences could not be obtained. These results indicate that in P. berghei the CDP-DAG pathway cannot compensate for the absence of the Kennedy routes. When analysing the CDP-Cho and CDP-Etn pathways in P. berghei separately, disruption of neither cct nor ect, could be obtained indicating that each branch of the Kennedy pathways is essential for parasite survival. This indicates that the PC provided by the CDP-Cho branch of the Kennedy pathway cannot be compensated by PE coming from the Kennedy or the CDP-DAG pathway using the PE-methylation enzymes. Most interestingly, de novo synthesized PE cannot be compensated by PE obtained from the CDP-DAG pathway. Again, this is different from yeast where choline kinase or ethanolamine kinase mutants exhibit growth properties similar to the wild type, indicating that none of the Kennedy pathways is essential. These results suggest an absence of redundancy in the synthesis of PC and PE in Plasmodium what is in contrast to yeast, where each de novo pathway can be compensated by the CDP-DAG pathway. | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |