Back to search resultsSummaryRMgm-312
|
||||||||
*RMgm-312| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene disruption |
| Reference (PubMed-PMID number) | Not published (yet) |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | T. Annoura, C.J. Janse, S.M. Khan |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-312 |
| Principal name | 1318cl3 |
| Alternative name | H-ko |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Not different from wild type |
| Fertilization and ookinete | Not different from wild type |
| Oocyst | Normal numbers of oocysts are produced. In mature oocysts sporozoites are formed comparable to wild type. However, sporozoites do not egress from the oocysts (and only very low numbers of hemocoel sporozoites are detected) |
| Sporozoite | Sporozoites do not egress from the oocysts. Only very low numbers of hemocoel sporozoites are detected. Analysis of dissected salivary glands showed very low numbers of sporozoites (3800 sporozoites) compared to wild type (126.500 sporozoites). No further analysis was performed to determine whether these sporozoites are inside the salivary glands or were attached to the outside of the glands. |
| Liver stage | No blood stage infection after infection of mice by bite of infected mosquitoes |
| Additional remarks phenotype | Mutant/mutation Additional information The phenotype has not been published. The mutant can be obtained from the Leiden Malaria Research Group. |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1433700 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1218100 | ||||||||||||||||||||||||
| Gene product | conserved Plasmodium protein, unknown function | ||||||||||||||||||||||||
| Gene product: Alternative name | H | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AGCTTGGGCCCCCGCGGTGGCGGCCGCTCTAGCTTTGATCCCGTTTTTCTTACTTATATA
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||