SummaryRMgm-31
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene tagging |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 17158894 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | K.D. Augustijn, C.J. Janse, A.P. Waters |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center |
City | Leiden |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-31 |
Principal name | 618cl1 |
Alternative name | pbMIF-MYC |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Expression of the c-myc-tagged protein (MIF-MYC) throughout asexual stages; IFA analysis using c-myc antibodies showed low staining in early ring forms. Staining in trophozoites and schizonts appeared to be restricted to parasitophorous vacuole. |
Gametocyte/Gamete | Normal gametocytes; gametocytes expressed the c-myc tagged proteins as shown by IFA analysis using c-myc antibodies |
Fertilization and ookinete | Not tested |
Oocyst | Not tested |
Sporozoite | Normal sporozoite numbers and sporozoite infectivity to mice |
Liver stage | Normal sporozoite numbers and sporozoite infectivity to mice. High expression of MIF::myc in liver stages (in vitro) |
Additional remarks phenotype | Mutant/mutation Protein (function) Phenotype Analyses of mosquito and liver stages: not published (yet). Analyses performed in 2020 in Leiden: Normal sporozoite numbers and sporozoite infectivity to mice. High expression of MIF::myc in liver stages (in vitro) Other mutants |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1444000 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1229400 | ||||||||||||||||||||||||||
Gene product | macrophage migration inhibitory factor | ||||||||||||||||||||||||||
Gene product: Alternative name | MIF | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Name of the tag | c-myc | ||||||||||||||||||||||||||
Details of tagging | C-terminal | ||||||||||||||||||||||||||
Additional remarks: tagging | |||||||||||||||||||||||||||
Commercial source of tag-antibodies | Sigma C3956 0.2 ml | ||||||||||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map |
![]() | ||||||||||||||||||||||||||
Plasmid/construct sequence |
![]() ![]() GGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGCATGCCTGCAGGTCAACAATAAA
| ||||||||||||||||||||||||||
Restriction sites to linearize plasmid | SnaBI | ||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |