Summary

RMgm-304
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0716400; Gene model (P.falciparum): PF3D7_0414400; Gene product: conserved Plasmodium protein, unknown function (L)
PhenotypeNo phenotype has been described
Last modified: 11 July 2014, 10:03
  *RMgm-304
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Not published (yet)
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherT. Annoura, C.J. Janse, S.M. Khan
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-304
Principal name1344cl4
Alternative nameL-ko
Standardized name
Is the mutant parasite cloned after genetic modificationNo
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The parasite lacks expression of PBANKA_071640

Protein (function)
No information (see 'Additional information').

Phenotype
The phenotype has not been analysed in detail. Blood stage development and gametocyte and ookinete production were comparable to those of wild type. Oocyst and sporozoite production and prepatent period after infection of mice by mosquito bite was comparable to those of wild type parasites.
The mutant can be obtained from the Leiden Malaria Research Group.

Additional information
The gene (gene L) was selected in a screen for genes with abundant transcripts in salivary gland sporozoites and the absence of the protein product as reported in proteome analyses of sporozoites.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0716400
Gene Model P. falciparum ortholog PF3D7_0414400
Gene productconserved Plasmodium protein, unknown function
Gene product: Alternative nameL
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AGCTTGGGCCCCCGCGGTGGCGGCCGCTCTAGCTTTGATCCCGTTTTTCTTACTTATATA
TTTATACCAATTGATTGTATTTATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTT
TTTGTGCATGCACATGCATGTAAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGA
AAAAAAAAACTTTACACACATAAAATGGCTAGTATGAATAGCCATATTTTATATAAATTA
AATCCTATGAATTTATGACCATATTAAAAATTTAGATATTTATGGAACATAATATGTTTG
AAACAATAAGACAAAATTATTATTATTATTATTATTTTTACTGTTATAATTATGTTGTCT
CTTCAATGATTCATAAATAGTTGGACTTGATTTTTAAAATGTTTATAATATGATTAGCAT
AGTTAAATAAAAAAAGTTGAAAAATTAAAAAAAAACATATAAACACAAATGATGTTTTTT
CCTTCAATTTCGATTGATAATTCCTGCAGCCCAGCTTAATTCTTTTCGAGCTCTTTATGC
TTAAGTTTACAATTTAATATTCATACTTTAAGTATTTTTTGTAGTATCCTAGATATTGTG
CTTTAAATGCTCACCCCTCAAAGCACCAGTAATATTTTCATCCACTGAAATACCATTAAA
TTTTCAAAAAAATACTATGCATATAATGTTATACATATAAACATAAAACGCCATGTAAAT
CAAAAAATATATAAAAATATGTATAAAAATAAATATGCACTAAATATAAGCTAATTATGC
ATAAAAATTAAAGTGCCCTTTATTAACTAGAACTAGTCGTAATTATTTATATTTCTATGT
TATAAAAAAATCCTCATATAATAATATAATTAATATATGTAATGTTTTTTTTATTTTATA
ATTTTAATATAAAATAATATGTAAATTAATTCAAAAAATAAATATAATTGTTGTGAAACA
AAAAACGTAATTTTTTCATTTGCCTTCAAAATTTAAATTTATTTTAATATTTCCTAAAAT
ATATATACTTTGTGTATAAATATATAAAAATATATATTTGCTTATAAATAAATAAAAAAT
TTTATAAAACATAGGGGGATCCATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCA
GAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAACGAATTTAG
ATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTAT
GGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAA
TTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAG
TCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGT
CTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAA
ACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGA
TTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGA
GAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATGCTAGCGGAGGAGGTGG
ATCTGGTGGAGGTGGAAGTGCTAGCGTGACAGGGGGAATGGCAAGCAAGTGGGATCAGAA
GGGTATGGACATTGCCTATGAGGAGGCGGCCTTAGGTTACAAAGAGGGTGGTGTTCCTAT
TGGCGGATGTCTTATCAATAACAAAGACGGAAGTGTTCTCGGTCGTGGTCACAACATGAG
ATTTCAAAAGGGATCCGCCACACTACATGGTGAGATCTCCACTTTGGAAAACTGTGGGAG
ATTAGAGGGCAAAGTGTACAAAGATACCACTTTGTATACGACGCTGTCTCCATGCGACAT
GTGTACAGGTGCCATCATCATGTATGGTATTCCACGCTGTGTTGTCGGTGAGAACGTTAA
TTTCAAAAGTAAGGGCGAGAAATATTTACAAACTAGAGGTCACGAGGTTGTTGTTGTTGA
CGATGAGAGGTGTAAAAAGATCATGAAACAATTTATCGATGAAAGACCTCAGGATTGGTT
TGAAGATATTGGTGAGGCTTCGGAACCATTTAAGAACGTCTACTTGCTACCTCAAACAAA
CCAATTGCTGGGTTTGTACACCATCATCAGAAATAAGAATACAACTAGACCTGATTTCAT
TTTCTACTCCGATAGAATCATCAGATTGTTGGTTGAAGAAGGTTTGAACCATCTACCTGT
GCAAAAGCAAATTGTGGAAACTGACACCAACGAAAACTTCGAAGGTGTCTCATTCATGGG
TAAAATCTGTGGTGTTTCCATTGTCAGAGCTGGTGAATCGATGGAGCAAGGATTAAGAGA
CTGTTGTAGGTCTGTGCGTATCGGTAAAATTTTAATTCAAAGGGACGAGGAGACTGCTTT
ACCAAAGTTATTCTACGAAAAATTACCAGAGGATATATCTGAAAGGTATGTCTTCCTATT
AGACCCAATGCTGGCCACCGGTGGTAGTGCTATCATGGCTACAGAAGTCTTGATTAAGAG
AGGTGTTAAGCCAGAGAGAATTTACTTCTTAAACCTAATCTGTAGTAAGGAAGGGATTGA
AAAATACCATGCCGCCTTCCCAGAGGTCAGAATTGTTACTGGTGCCCTCGACAGAGGTCT
AGATGAAAACAAGTATCTAGTTCCAGGGTTGGGTGACTTTGGTGACAGATACTACTGTGT
TTAACTCGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTATTTATAACTG
TAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGTAAATAGCT
AAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACATAAAATGGC
TAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGACCATATTAAAA
ATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTATTATTATTAT
TATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGTTGGACTTG
ATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAAAAATTAAA
AAAAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCGGGTACGTACCCTCGAGG
CTAGCGATATCGAATTCAATTGCATTTTATATACCCGCGTTTTTTATATTTGTTTTATTT
CCCTTCACATTTTAGCGTGAAGTTCTGTATAATATTTTTATAATTTTGTATCGAATATTT
TTATATGAACAATTTTATTATATTTTTATTTTATGGCTTTTTTGTTTAGTTGTTTTTTAA
TACGAAATATAAAAAATTATGTATAATATATATGTCCTCGTTGAATAGACTATTAAGGAG
CACGGTTAAAAACAATACTATAAAGGTCTCAATTGTTTAAGAAAACGAGAAACTAAAAAT
ACACAAATAAAATAAAAATAATATAACATAAAAATAAACTACAAATTAAAATTGTGGTTA
AAAGCTAAAAAGGCCATTGAAAAAAACTCAAAAAATGACATATAAATTAATTGTTATAAT
CCGGTTGTTGCATATTTTCAATCGAATTTGGATAATAATTATAGTTGGAATAAAAATCTG
GAACGTTTTGAAACCTTTGGTTAAATAAAAAGGGTACTCCACATGCATTGTACATAAAAT
TTGCCCACTGACTCATACTTTCTTTGTTATAAGGGAAAGGGCCCATAAAAGGAGGAAGGT
GGGAATATTTTGAATGACTAAAAAGGACGAAATAAATAAGTAAAAAATAAGAAAATACAT
ATATATATAAATATTCGAATATGCAAAATTAAAATACTCTTAAAAAAAATAATTATATAC
TACCTTTTATTATTTTGTCGTTTTATAGACATTTTTGGCTTCTTAGGTTCGGCTTTTCTA
ACTTCAACCATTTTATCCTAATTAAAAAAAAAAAAAATTATTAATATATACGCATATTTA
CAATATAATAATATTATACTAAGGACATATGCATATTCTCCTCCCCGGGGGATCCACTAG
TTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACA
ATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTA
ATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCG
ATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCG
CATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCC
TAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCC
GTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCG
ACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGG
TTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTG
GAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTT
CGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAA
TATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTG
TTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAAT
GCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTAT
TCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGT
AAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAG
CGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAA
AGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCG
CCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCT
TACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACAC
TGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCA
CAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCAT
ACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACT
ATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGC
GGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGA
TAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGG
TAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACG
AAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCA
AGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTA
GGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCA
CTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCG
CGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGA
TCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAA
TACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCC
TACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTG
TCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAAC
GGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCT
ACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC
GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTG
GTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATG
CTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCT
GGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGA
TAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCG
CAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC
GCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAG
TGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTT
TATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAA
CAGCTATGACCATGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCT
GGTACCGCATAGGCTTAAAATTAATCACATAATGTTGTTATATTTTATTGATGGAAACTA
AAAAAAATGGTTATAAATCCTTTAAACTCTTAATAATTAAAGTGAAATAAATGTAAAAAT
TATAAATTGTTTTTCCAAAAAAAAACAAGAACGGTTTGATTTGTTTTATATAAAACAACT
GACGTTTTGAATAACAAATTTGATAAAAAAAAAAAATTATTAACATGGAATATAAAAAAG
ACAAACTATTAAGCTGCCTCGAAAAATGCATTCACATATTTTTATGTGTATACCTTCAAG
TACGATTTCTTAATATATATAAGATCCCCTATAAGTATGTCCATAAGAATATTATCAAAT
AATTTCGATATAAAATTAAATGCGAATTTTCTCCAATATCTTTTAATATTTTATAAAAAA
ATTAATTTTTTTTTATAAATGAAAATATAAATATGTTATTGCATTTCAGGTGCCCACGAT
ATTTTAATACGCACGTCGTTTTAAAAAAAATTGCTTTTTAATATAATTGCAACTATAAAA
AACATATTTTTCAATTTATAATTTTATAAATAGTATAAAAAATGAAGAAATATAAACATG
TGTGAAATAATTTTTTTTTATAAAACATGAAAAAAATTGGTTGCATATATATATATATAG
TATGTGTCTATTTTCGTAATTTTCATTA
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCGCATAGGCTTAAAATTAATCAC
Additional information primer 1L4136 (Asp718); 5'
Sequence Primer 2CCCAAGCTTAATGAAAATTACGAAAATAGACAC
Additional information primer 2L4137 (HindIII); 5'
Sequence Primer 3GGAATTCAATTGCATTTTATATACCCGCG
Additional information primer 3L4138 (EcoRI); 3'
Sequence Primer 4TCCCCCCGGGGAGGAGAATATGCATATGTCC
Additional information primer 4L4139 (XmaI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6