top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: Plasmodium |
Gene Model of Parasite |
PBANKA_1418900
|
Gene Model P. falciparum ortholog |
PF3D7_1320600
|
Gene product | ras-related protein Rab-11A |
Gene product: Alternative name | |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | hdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The mutant expresses a GFP-tagged version (N-terminal) of Rab11A under the control of the 5'- and 3'-UTR regions of rab11a. The gfp-rab11a gene is inserted by single cross-over integration into the 5'-UTR region of rab11a resulting in the presence of both a gfp-tagged version of rab11a and an intact copy of rab11a.
The pDH-GPF11a plasmid was made from a two-step procedure: first Pbrab11a fragment was PCR amplified with the primers PbCDS11a-For (GAGCTCATGTCAATGAAAGAGGATTATTACGA; SacI site is underlined), and PbCDS11a-Rev (AAGCTTCGGGAGTTGTTATATTACTGAAAAT; HindIII site is underlined) using P. berghei cDNA as template, the 5′-UTR fragment was PCR amplified with the primers Pbrab11a-5′UTR-KI-For (GTATAAGCTTTATATTTTGTATATTT; HindIII site is underlined) and Pbrab11a-5′UTR-KI-Rev (GAAATGTCGACATATGTAGAAG; SalI site is underlined) and the GFP gene was PCR amplified with the primers GFP-For (CGCGCGGTCGACATGAGTAAAGGAGAAGAAC; SalI site is underlined) and GFP-Rev (CCCGGGGAGCTCTTGTTTGTATAGTTCATCCA; SacI site is underlined and the stop codon was mutated). Each fragment was cloned using the TA Cloning Simplifies PCR Cloning kit (Invitrogen), the plasmids were digested with the appropriate enzyme and cloned into the pDEF-hDHFR targeting vector resulted in plasmid pDHFR-GFP-Rab11A. |
Additional remarks selection procedure | |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_1418900
|
Gene Model P. falciparum ortholog |
PF3D7_1320600
|
Gene product | ras-related protein Rab-11A |
Gene product: Alternative name | |
Primer information details of the primers used for amplification of the promoter sequence
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | GTATAAGCTTTATATTTTGTATATTT |
Additional information primer 1 | Pbrab11a-5′UTR-KI-For (HindIII) |
Sequence Primer 2 | GAAATGTCGACATATGTAGAAG |
Additional information primer 2 | Pbrab11a-5′UTR-KI-Rev (SalI) |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_1418900
|
Gene product | ras-related protein Rab-11A |
Gene product: Alternative name | |
Primer information details of the primers used for amplification the 3'-UTR sequences
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Insertion locus |
Gene Model of Parasite |
PBANKA_1418900
|
Gene product | ras-related protein Rab-11A |
Gene product: Alternative name | |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | GTATAAGCTTTATATTTTGTATATTT |
Additional information primer 1 | Pbrab11a-5′UTR-KI-For (HindIII) |
Sequence Primer 2 | GAAATGTCGACATATGTAGAAG |
Additional information primer 2 | Pbrab11a-5′UTR-KI-Rev (SalI) |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
|
|
top of page |