RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-299
Malaria parasiteP. berghei
Genotype
Transgene
Transgene Plasmodium: Gene model: PBANKA_1418900; Gene model (P.falciparum): PF3D7_1320600; Gene product: ras-related protein Rab-11A
Promoter: Gene model: PBANKA_1418900; Gene model (P.falciparum): PF3D7_1320600; Gene product: ras-related protein Rab-11A
3'UTR: Gene model: PBANKA_1418900; Gene product: ras-related protein Rab-11A
Insertion locus: Gene model: PBANKA_1418900; Gene product: ras-related protein Rab-11A
Phenotype Asexual bloodstage; Gametocyte/Gamete;
Last modified: 28 June 2009, 12:19
  *RMgm-299
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19165333
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherC. Agop-Nersesian; M. Meissner; G. Langsley
Name Group/DepartmentHygieneinstitut, Department of Parasitology
Name InstituteUniversity Hospital Heidelberg
CityHeidelberg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-299
Principal namePbGFPrap11a
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageA rather diffuse, vesicular localisation of GFP-Rab11A was found in asexual trophozoites and mature gametocytes. Schizonts show a clear apical localisation of GFP expression.
Gametocyte/GameteA rather diffuse, vesicular localisation of GFP-Rab11A was found in asexual trophozoites and mature gametocytes.
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a GFP-tagged version (N-terminal) of Rab11A under the control of the 5'- and 3'-UTR regions of rab11a. The gfp-rab11a gene is inserted into the 5'-UTR region of rab11a resulting in the presence of both a gfp-tagged version of rab11a and an intact copy of rab11a.

Protein (function)
Rab genes encode a subgroup of small GTP-binding proteins within the ras super-family that regulate targeting and fusion of transport vesicles within the secretory and endocytic pathways. In the genome of P. falciparum 11 genes have been identified that encode Rab GTPases. Rab11A is highly conserved in apicomplexan parasites. Unsuccessful attempts to disrupt Rab11A (RMgm-298) indicates an essential rol of Rab11A during asexual blood stage development.

Phenotype
A rather diffuse, vesicular localisation of GFP-Rab11A was found in trophozoites and gametocytes, whereas in schizonts, a clear apical-like localisation was observed. The results indicate that Rab11A has a dynamic localisation during intra-erythrocytic development associating with rhoptries only after their biogenesis.

Additional information
The analysis of GFP-Rab11A localisation confirmed data from IFA, RT-PCR and microarray data that Rab11A  expression occurs during development of the trophozoite into the schizont and free merozoites.
Proof that the GFP-Rab11A is functionally active came from its ability to “rescue” parasites lacking the endogenous rab11a gene, when the GFP-tagged version was expressed off an episome. Unsuccessful attempts to disrupt rab11a indicate that a functional Rab11A is essential for blood stage development (see RMgm-298).
The results indicate that Rab11A has a dynamic localisation during intra-erythrocytic development associating with rhoptries only after their biogenesis. The changing distribution of Rab11A indicate that the GTPase could be performing non-rhoptry associated functions during development of the parasite within red blood cells. Based on studies in both Toxoplasma gondii and P. falciparum evidence is presented in this paper that Rab11A mediated transport might be involved in Inner Membrane Complex (IMC) maturation and IMC interaction with the plasma membrane and also might deliver components of the proto-glidosome to the IMC. It is speculated that Rab11A transports vesicles derived from endosome-like compartments, similar to its known function in other eukaryotes.

Other mutants
RMgm-298: Unsuccessful attempts to disrupt Rab11A


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: Plasmodium
Gene Model of Parasite PBANKA_1418900
Gene Model P. falciparum ortholog PF3D7_1320600
Gene productras-related protein Rab-11A
Gene product: Alternative name
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe mutant expresses a GFP-tagged version (N-terminal) of Rab11A under the control of the 5'- and 3'-UTR regions of rab11a. The gfp-rab11a gene is inserted by single cross-over integration into the 5'-UTR region of rab11a resulting in the presence of both a gfp-tagged version of rab11a and an intact copy of rab11a.
The pDH-GPF11a plasmid was made from a two-step procedure: first Pbrab11a fragment was PCR amplified with the primers PbCDS11a-For (GAGCTCATGTCAATGAAAGAGGATTATTACGA; SacI site is underlined), and PbCDS11a-Rev (AAGCTTCGGGAGTTGTTATATTACTGAAAAT; HindIII site is underlined) using P. berghei cDNA as template, the 5′-UTR fragment was PCR amplified with the primers Pbrab11a-5′UTR-KI-For (GTATAAGCTTTATATTTTGTATATTT; HindIII site is underlined) and Pbrab11a-5′UTR-KI-Rev (GAAATGTCGACATATGTAGAAG; SalI site is underlined) and the GFP gene was PCR amplified with the primers GFP-For (CGCGCGGTCGACATGAGTAAAGGAGAAGAAC; SalI site is underlined) and GFP-Rev (CCCGGGGAGCTCTTGTTTGTATAGTTCATCCA; SacI site is underlined and the stop codon was mutated). Each fragment was cloned using the TA Cloning Simplifies PCR Cloning kit (Invitrogen), the plasmids were digested with the appropriate enzyme and cloned into the pDEF-hDHFR targeting vector resulted in plasmid pDHFR-GFP-Rab11A.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1418900
Gene Model P. falciparum ortholog PF3D7_1320600
Gene productras-related protein Rab-11A
Gene product: Alternative name
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1GTATAAGCTTTATATTTTGTATATTT
Additional information primer 1Pbrab11a-5′UTR-KI-For (HindIII)
Sequence Primer 2GAAATGTCGACATATGTAGAAG
Additional information primer 2Pbrab11a-5′UTR-KI-Rev (SalI)
3'-UTR
Gene Model of Parasite PBANKA_1418900
Gene productras-related protein Rab-11A
Gene product: Alternative name
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite PBANKA_1418900
Gene productras-related protein Rab-11A
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GTATAAGCTTTATATTTTGTATATTT
Additional information primer 1Pbrab11a-5′UTR-KI-For (HindIII)
Sequence Primer 2GAAATGTCGACATATGTAGAAG
Additional information primer 2Pbrab11a-5′UTR-KI-Rev (SalI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4