Back to search resultsSummaryRMgm-283
|
||||||||
*RMgm-283| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene disruption |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 19438517 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | M. Ponzi, C.J. Janse, P. Alano |
| Name Group/Department | Dipartimento di Malattie Infettive, Parassitarie e Immunomediate |
| Name Institute | Istituto Superiore di Sanità |
| City | Rome |
| Country | Italy |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-283 |
| Principal name | 678cl1; 721cl1 |
| Alternative name | Δmdv-1/peg3 |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Normal numbers of male and female gametocytes are produced. Both male and female gametocytes showed a strong reduction in egress from the host erythrocyte, resulting in strongly decreased fertilisation rates. |
| Fertilization and ookinete | Gametocytes were strongly impaired in their capacity to produce mature ookinetes. Although small numbers of ookinetes were formed, they represented at most 6% (range 0–6%) of the ookinete production observed in wild type parasites. The small number of ookinetes produced normal oocysts and infectious sporozoites. |
| Oocyst | Not different from wild type |
| Sporozoite | Not different from wild type |
| Liver stage | Not different from wild type |
| Additional remarks phenotype | Mutant/mutation Additional information An independent mutant lacking expression of MDV-1/PEG3 has been described (RMgm-231) that showed a slightly different phenotype. Both female and male gametocytes were strongly impaired in fertilisation and production of ookinetes. In addition, ookinetes lacking expression of MDV-1/PEG3 showed an impaired development, suggesting of an additional role of MDV-1/PEG3 in the ookinete stage. Other mutants |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1432200 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1216500 | ||||||||||||||||||||||||
| Gene product | male development gene 1 | protein of early gametocyte 3 | ||||||||||||||||||||||||
| Gene product: Alternative name | MDV-1; PEG3; MDV-1/PEG3 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() ATCCCCTGAAGAAGAAATTGATCATTTTGCAGATGATTTAACTGATAAATATGAAGTTAA
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | MluNI/XbaI | ||||||||||||||||||||||||
| Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | First 122 bp of the 645bp ORF intact | ||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||