Back to search resultsSummaryRMgm-263
|
||||||||
*RMgm-263| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene disruption |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25262869 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | A. Oliviera; B. Franke-Fayard, C.J. Janse; M. Ponzi |
| Name Group/Department | Dipartimento di Malattie Infettive, Parassitarie ed Immunomediate |
| Name Institute | Istituto Superiore di Sanità |
| City | Rome |
| Country | Italy |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-263 |
| Principal name | ΔPbg377 |
| Alternative name | 600cl1, 622cl1 |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Production of gametocytes was slightly reduced in clone ΔPbg377-b (622cl1) compared to WT, while the other clone (600cl1) examined was similar to WT. In female gametocytes typical osmiophilic bodies (OB) were not detected by Transmission Electron Microscopy (TEM) but only tiny osmiophilic vesicles, which were reduced in size compared to OB of WT females. The altered morphology of OB in mutant parasites was confirmed by determining minimum and maximum size values of more than a hundred OB sections present in TEM micrographs of WT and ΔPbg377 gametocytes. These observations indicate that Pbg377 may have a structural role in defining the shape of female OB. Absence of this protein does not result in a near complete lack of OB, as described for P. falciparum mutant lacking Pfg377, but instead results in a dramatic change in OB morphology. 15 min post activation of gametocytes a reduction of approximately 60% in egress of females from the host erythrocyte was observed in mutant parasites compared to the WT, while males emerged normally, as expected. At 20 min, egress of mutant female gametocytes/gametes was comparable to the WT. These observations indicate that in the absence of normal OB, female gametocytes are able to egress from the host erythrocyte, although less efficiently than the WT. |
| Fertilization and ookinete | Not different from wild type |
| Oocyst | Not different from wild type |
| Sporozoite | Not different from wild type |
| Liver stage | Not different from wild type |
| Additional remarks phenotype | Mutant/mutation Protein (function) Additional information Evidence is presented for co-localisation with MDV1/PEG3, a protein localised in osmiophilic bodies (OB). Immune electron microscopy (IEM), revealed that both Pbg377 and MDV1/PEG3 reside in the characteristic oval-shaped OB of female gametocytes. A P. falciparum has been generated lacking expression of Pfg377. Female gametocytes of this mutant are significantly less efficient in their emergence from the erythrocytes upon induction of gamete formation (de Koning-Ward, T.F. et al. Mol. Microbio. (2008) 67:278-90). Other mutants |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1463000 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1250100 | ||||||||||||||||||||||||
| Gene product | osmiophilic body protein G377 | ||||||||||||||||||||||||
| Gene product: Alternative name | PbG377 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() GTGCTTATAAATAATTAAAGCCAATTTTATAATATATATTTTTTTATTTAATTTGAATTT
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | The ORF of PbG377 reads 1839 bp (PlasmoDB). The selectable marker was inserted between bp positions 138 and 1630, replacing everything in between. | ||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||