Back to search resultsSummaryRMgm-257
|
||||||||||
*RMgm-257| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene disruption, Introduction of a transgene |
| Reference (PubMed-PMID number) | Not published (yet) |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
| Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | S.M. Khan, C.J. Janse |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-257 |
| Principal name | 826cl1, 826cl2 |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Not tested |
| Fertilization and ookinete | Not tested |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation Protein (function) The NIMA-related protein kinases (Neks) constitute an extended family of eukaryotic mitotic serine/threonine kinases. The best characterized members of the Nek family include NIMA (never in mitosis/Aspergillus), the founding member from the fungus Aspergillus nidulans, and its closest homologue in mammals, Nek2. Initially identified as a kinase essential for mitotic entry in Aspergillus, NIMA has been also shown to participate in nuclear membrane fission. Eleven members of the NIMA kinase family (Nek1-11) have now been identified in various human tissues, and together fulfil a number of cell cycle-related functions in centrosome separation, mitosis, meiosis and checkpoint control. The P. falciparum kinome includes four NIMA-related serine/threonine kinases. Pfnek-1 (PlasmoDB identifier PFL1370w) clusters within the Aspergillus NIMA/human Nek2 branch in phylogenetic trees, while clear orthology to mammalian or yeast Neks could not be assigned for the three other P. falciparum sequences (Pfnek-2, -3 and -4, PlasmoDB identifiers PFE1290w, PFL0080c and MAL7P1.100,respectively). Phenotype Additional information |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0616700 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0719200 | ||||||||||||||||||||||||
| Gene product | NIMA related kinase 4 | ||||||||||||||||||||||||
| Gene product: Alternative name | serine/threonine protein kinase, Pfnek-4 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() "ATCTTATTTTCATAATATATGCACCATATTAATTAACAATTCTATTATTAGATCCCCGAT
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | ClaI, XbaI | ||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
Transgene: Mutant parasite expressing a transgene| top of page | |||||||||||||||||||
| Type and details of transgene | |||||||||||||||||||
| Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
| Transgene name | GFP (gfp-mu3) | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||
| Type of plasmid/construct | Plasmid double cross-over | ||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
| ||||||||||||||||||
| Restriction sites to linearize plasmid | KspI (SacII) | ||||||||||||||||||
| Selectable marker used to select the mutant parasite | gfp (FACS) | ||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||
| Selection (positive) procedure | FACS (flowsorting) | ||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||
| Additional remarks genetic modification | The GFP gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration. | ||||||||||||||||||
| Additional remarks selection procedure | This reporter mutant expressing GFP does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence. | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Other details transgene | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Promoter | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_1133300 | ||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1357100 | ||||||||||||||||||
| Gene product | elongation factor 1-alpha | ||||||||||||||||||
| Gene product: Alternative name | eef1a | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||
| 3'-UTR | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
| Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
| Gene product: Alternative name | dhfr-ts | ||||||||||||||||||
| |||||||||||||||||||
| Insertion/Replacement locus | |||||||||||||||||||
| Replacement / Insertion | Replacement locus | ||||||||||||||||||
| Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
| Gene product | 6-cysteine protein | ||||||||||||||||||
| Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||