Back to search resultsSummaryRMgm-255
|
||||||||||
*RMgm-255| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 3 |
| Reference (PubMed-PMID number) | Not published (yet) |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
| Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190). |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | E. Laurentino, C.J. Janse |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1232200 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0517400 | ||||||||||||||||||||||||
| Gene product | FACT complex subunit SPT16, putative | ||||||||||||||||||||||||
| Gene product: Alternative name | FACT-L; FACT | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | PB000119.00.0 reads 3231 bp (PlasmoDB). The selectable marker was inserted between bp positions 1090 and 2502, replacing everything in between. | ||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | The unsuccessful ttempts to disrupt the fact-l gene in P. berghei indicates an essential role of FACT-L for blood stage development/multiplication. See also RMgm-652, RMgm-653 and RMgm-654 for mutants in which the promoter of fact-l is replaced by an 'asexual blood stage specific’ promoter that is silent in gametocytes (the promoter of PBANKA_140060). Disruption experiments were performed in the Leiden Malaria Research Group (Exp. 902, 917; pl1230) An additional attempt to disrupt the gene was performed using a different plasmid targeting a bigger part of the gene (double cross-over integration; exp. 1147; pl1147). Primers used to amplify the target sequences are L3576 (SacII): gcCCGCGGATGCAATCCTTATTAGTG; L3576 (StuI): gcAGGCCTCATCTGATTTAGATCTAAG; L3577 (XhoI): cCTCGAGCTAGAAAGAGTACATCATGG; L3578 (EcoRV): gcGATATCGCGTTCATTTCATATATAAC. The selectable marker was inserted between bp positions 519 and 2742 of the PB000119.00.0 ORF, replacing everything in between. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||