SummaryRMgm-253
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption |
Reference (PubMed-PMID number) | Not published (yet) |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | C.J. Janse |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center |
City | Leiden |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-253 |
Principal name | 831cl1 (cl2,3) |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Not different from wild type |
Sporozoite | Not different from wild type |
Liver stage | Not different from wild type |
Additional remarks phenotype | Mutant/mutation Protein (function) Phenotype Additional information
Other mutants |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0932200 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1115600 | ||||||||||||||||||||||||
Gene product | peptidyl-prolyl cis-trans isomerase | ||||||||||||||||||||||||
Gene product: Alternative name | |||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map |
![]() | ||||||||||||||||||||||||
Plasmid/construct sequence |
![]() ![]() GGGCCCTCTTAAAGGCAACGCATATCTCCAAATTATTTAATATAATTCTAAAATATTTTG
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
![]()
| |||||||||||||||||||||||||
top of page |