RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-242
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1364300; Gene model (P.falciparum): PF3D7_1351600; Gene product: glycerol kinase
PhenotypeNo phenotype has been described
Last modified: 21 April 2009, 15:49
  *RMgm-242
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 2
Reference (PubMed-PMID number) Not published (yet)
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherD.A. Baker, C.J. Janse
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1364300
Gene Model P. falciparum ortholog PF3D7_1351600
Gene productglycerol kinase
Gene product: Alternative name
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationDisruption experiments were performed in the Leiden Malaria Research Group (exp. 586, 613; pl1030).

A P. falciparum mutant lacking expression of glycerol kinase has been generated (Schnick C. et al., 2009; Mol. Microbiol. 71:533-45). Deletion of the glycerol kinase gene from P. falciparum had no effect on asexual parasite growth, gametocyte development and exflagellation of male gametocytes.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1gcgggtaccctgtaatacattagcattaacg
Additional information primer 15'forward; 466bp
Sequence Primer 2gcgaagcttgttgtaccataaataca
Additional information primer 25'reverse; 466bp
Sequence Primer 3gcggaattctgttgtttccaatttgaattgg
Additional information primer 33'forward; 485bp
Sequence Primer 4gcgggatccctaacttcagtttgtctaaca
Additional information primer 43'reverse; 485bp
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren