RMgmDB - Rodent Malaria genetically modified Parasites
SummaryRMgm-238
|
||||||||||
Last modified: 19 July 2012, 15:45
*RMgm-238| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 3 |
| Reference (PubMed-PMID number) | Not published (yet) |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | G.R. Mair, S.M. Khan, C.J. Janse |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0903600 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1145400 | ||||||||||||||||||||||||
| Gene product | dynamin-like protein | ||||||||||||||||||||||||
| Gene product: Alternative name | DYN1; dynamin1 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
  
| ||||||||||||||||||||||||
| Plasmid/construct sequence |
ATCCTATGTTAAATAATTCTCCATCACAATCTTATAAACAAAATTTTATTTCGTCACATA
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | Based on proteome analyses, the protein appears to be expressed in asexual blood stages and very highly expressed in gametocyte stages (both male and female). Disruption experiments were performed in the Leiden Malaria Research Group (exp. 674, 686, 697; pl1094). | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||