Mutant/mutation
The mutant lacks expression of CDPK6

Protein (function)
CDPKs of Plasmodium belongs to an expanded family of Ca²⁺ dependent protein kinases (CDPKs). CDPKs combine an amino-terminal serine/threonine kinase domain and a carboxy-terminal calmodulin-like domain, composed of four EF hands, in the same molecule. In plants, CDPKs translate Ca²⁺ signals generated by external stimuli into cellular responses, thereby regulating cell division and differentiation, the development of tolerance to stress stimuli and the specific defense responses to pathogens.
According to the authors, CDPK6 should be grouped within the CDPK family of Plasmodium. CDPK-6 is predicted to encode an atypically large protein, characterized by a CDPK-like kinase domain, an incomplete carboxy-terminal calmodulin-like domain and an unusually large amino-terminal extension.

Phenotype
The phenotype analyses indicate that CDPK6 plays a role in sporozoite formation since fewer salivary gland sporozoites are produced. However, no quantitative data is provided on oocyst production and on the reduction in sporozoite formation. The phenotype analyses indicate that CDPK6 plays a role in invasion of hepatocytes.

Additional information
Mutant sporozoites displayed enhanced migratory activity and were significantly less infective for hepatocytes. Preincubation of  mutant sporozoites with soluble heparin could not enhance their invasive capacity. In vivo there was significant delay in the time to detectable blood-stage infection with mutant sporozoites compared to wild type. The majority of mutant sporozoites did not cleave CSP upon contact with hepatocytes. The results suggest that sporozoites after binding the hepatocytes undergoes activation via CDPK6 resulting in proteolysis of surface CSP. 

A second independent CDPK-6 mutant clone was generated using a two step PCR method as described in (Ecker A. et al., 2006). The primers used were K4pcr-1 TCCCATAAACTGTATTTTGTG; K4pcr-2 CGATCCGCGGGGGCCCAAGCTT GGCAATAACTCTAACACCATATCGTTAC; K4pcr-3 CGATGGGTACCCTCGAGGCTAGCGAGATTACATGTTGAGCACATTTTGA; K4pcr-4 AATATA GCGATGTGCTTTATAG.

Disruption of the P. falciparum ortholog has been succesful (Solyakov et al., 2011, Nat Commun, 2:565) indicating that this gene is not essential for asexual proliferation.

Other mutants