RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-227
Malaria parasiteP. berghei
Genotype
Transgene
 Transgene not Plasmodium: GFPmut2
Promoter: Gene model: PBANKA_0719300; Gene model (P.falciparum): PF3D7_0417200; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase (dhfr/ts)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Insertion locus: Gene model: PBANKA_1349800; Gene product: sporozoite surface protein 2 thrombospondin-related anonymous protein (sporozoite surface protein 2; SSP2; SSP-2)
Phenotype Asexual bloodstage; Oocyst; Sporozoite; Liver stage;
Last modified: 22 September 2009, 14:07
  *RMgm-227
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 10225926
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherA.A. Sultan, R. Menard
Name Group/DepartmentMichael Heidelberger Division of Immunology, Department of Pathology
Name InstituteKaplan Cancer Center
CityNew York
CountryUSA
top of page
Name of the mutant parasite
RMgm numberRMgm-227
Principal namePyrFlu-TRAP (INT)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageAll blood stages express DHFR-TS-GFP and are fluorescent.
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystOocysts express DHFR-TS-GFP and are fluorescent.
SporozoiteThe level of fluorescence emitted by sporozoites was low, and isolated sporozoites released in mosquito tissues could not be detected based on fluorescence.
Liver stageLiver stages express DHFR-TS-GFP and are fluorescent.
Additional remarks phenotype

Mutant/mutation
The mutant expresses a dhfr-ts-GFPmut2 fusion gene under the control of 2.5 kb of 5′- and 0.5 kb of 3′-UTR of P. berghei dhfr-ts. The dhfr-ts gene encodes a mutant DHFR-TS protein that confers resistance to pyrimethamine. The encoded fusion protein consists of all residues of each partner except the starting Met of GFPmut2, contains a Leu-Lys-Ala tripeptide linking TS and GFPmut2, and ends with an Ala-Glu-Phe tripeptide. The construct is integrated into the trap-locus (PB000374.03.0) without affecting expression of TRAP.

Protein (function)

Phenotype
The phenotype analyses indicate that the expression of  of DHFR-TS-GFP does not significantly alter parasite viability and infectivity.

Additional information
The construct used to generate the mutant, named PyrFlu, contains the fusion gene dhfr-ts-GFPmut2 that confers pyrimethamine resistance and directs the GFP fluorescence signal. The relatively small size of the bifunctional cassette (5 kb) is compatible with the generation of more complex targeting plasmids.

Other mutants

  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFPmut2
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SpeI
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe construct contains a dhfr-ts-GFPmut2 fusion gene under the control of 2.5 kb of 5′- and 0.5 kb of 3′-UTR of P. berghei dhfr-ts. The encoded fusion protein consists of all residues of each partner except the starting Met of GFPmut2, contains a Leu-Lys-Ala tripeptide linking TS and GFPmut2, and ends with an Ala-Glu-Phe tripeptide.

The construct contains ~3k of TRAP targeting sequence. Since the TRAP targeting sequence starts downstream from the start codon of the gene and ends ~1.5 kb downstream from the stop codon, homologous integration of the plasmid at the TRAP locus creates a recombinant locus that contains a full-length and expressed copy of TRAP. Thus, recombinant parasites should have a normal life cycle.
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_0719300
Gene Model P. falciparum ortholog PF3D7_0417200
Gene productbifunctional dihydrofolate reductase-thymidylate synthase
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1GCGGAATTCTAATGTTCGTTTTTCTTATTTATATAT
Additional information primer 1Ohar4 sense (EcoRI)
Sequence Primer 2GCGGGTACCGGATCCATCGAAATTGAAGGAAAAAACATCA
Additional information primer 2ONeca4 antisense (BamHI)
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite PBANKA_1349800
Gene productsporozoite surface protein 2 thrombospondin-related anonymous protein
Gene product: Alternative namesporozoite surface protein 2; SSP2; SSP-2
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren