top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
Transgene name | GFPmut2 |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
SpeI
|
Selectable marker used to select the mutant parasite | pbdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The construct contains a dhfr-ts-GFPmut2 fusion gene under the control of 2.5 kb of 5′- and 0.5 kb of 3′-UTR of P. berghei dhfr-ts. The encoded fusion protein consists of all residues of each partner except the starting Met of GFPmut2, contains a Leu-Lys-Ala tripeptide linking TS and GFPmut2, and ends with an Ala-Glu-Phe tripeptide.
The construct contains ~3k of TRAP targeting sequence. Since the TRAP targeting sequence starts downstream from the start codon of the gene and ends ~1.5 kb downstream from the stop codon, homologous integration of the plasmid at the TRAP locus creates a recombinant locus that contains a full-length and expressed copy of TRAP. Thus, recombinant parasites should have a normal life cycle. |
Additional remarks selection procedure | |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_0719300
|
Gene Model P. falciparum ortholog |
PF3D7_0417200
|
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase |
Gene product: Alternative name | dhfr/ts |
Primer information details of the primers used for amplification of the promoter sequence 
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_0719300
|
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative |
Gene product: Alternative name | dhfr/ts |
Primer information details of the primers used for amplification the 3'-UTR sequences 
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | GCGGAATTCTAATGTTCGTTTTTCTTATTTATATAT |
Additional information primer 1 | Ohar4 sense (EcoRI) |
Sequence Primer 2 | GCGGGTACCGGATCCATCGAAATTGAAGGAAAAAACATCA |
Additional information primer 2 | ONeca4 antisense (BamHI) |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Insertion locus |
Gene Model of Parasite |
PBANKA_1349800
|
Gene product | sporozoite surface protein 2 thrombospondin-related anonymous protein |
Gene product: Alternative name | sporozoite surface protein 2; SSP2; SSP-2 |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
|
|
top of page |