RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-219
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0719900; Gene model (P.falciparum): PF3D7_0417800; Gene product: cdc2-related protein kinase 1 (CRK-1)
PhenotypeNo phenotype has been described
Last modified: 21 December 2011, 13:01
  *RMgm-219
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 4
Reference (PubMed-PMID number) Reference 1 (PMID number) : 16375894
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherR. Rangarajan, C. Doerig, A. Sultan
Name Group/DepartmentDepartment of Immunology and Infectious diseases
Name InstituteHarvard School of Public Health
CityBoston
CountryUSA
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0719900
Gene Model P. falciparum ortholog PF3D7_0417800
Gene productcdc2-related protein kinase 1
Gene product: Alternative nameCRK-1
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid PstI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption A deletion construct containing 825 bp (202–1027) of the 1734-bp coding sequence was made. This DNA fragment contains the glycine-rich motif mediating ATP binding but not the HRD motif directly involved in catalysis of Pbcrk-1. Both sites are essential for a kinase to be functional.
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationCRK-1 is a family member of cyclin-dependent kinases (CDKs) and shows homology to yeast p34(cdc2), also called CDK1. CRK-1 of P. falciparum is predominantly expressed in gametocytes.

Pbcrk-1, the P. berghei orthologue of Pfcrk-1, was amplified from P. berghei genomic DNA using primers based on the Plasmodium yoelii orthologue of pfcrk-1 (PlasmoDB)(primers ATGGAAAGAAATATAAAACGAAAG; TGAACGAAACATAATTGTATTTTG).

A deletion construct containing 825 bp (202–1027) of the 1734-bp coding sequence was made. This DNA fragment contains the glycine-rich motif mediating ATP binding but not the HRD motif directly involved in catalysis of Pbcrk-1. Both sites are essential for a kinase to be functional.

Four independent transfections using this construct were unsuccessful, suggesting that CRK-1 is essential for asexual blood stages. In contrast, an integration event at this locus that did not result in a loss-of-function of the pbcrk-1 gene was readily observed indicating that the locus can be targeted by genetic modification.

See also RMgm-554 for unsuccessful attempts to disrupt PBANKA_071990

Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565).
The gene is likely essential for asexual proliferation. After transfection with a KO vector a weak PCR signal diagnostic for integration was observed, indicating that integration does transiently occur but parasites with a disrupted locus do not persist. Cloning will be required to validate this interpretation for this gene.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren