RMgmDB - Rodent Malaria genetically modified Parasites
SummaryRMgm-219
|
||||||||||
Last modified: 21 December 2011, 13:01
*RMgm-219| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 4 |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 16375894 |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei NK65 |
| Name parent line/clone | Not applicable |
| Other information parent line | |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | R. Rangarajan, C. Doerig, A. Sultan |
| Name Group/Department | Department of Immunology and Infectious diseases |
| Name Institute | Harvard School of Public Health |
| City | Boston |
| Country | USA |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0719900 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0417800 | ||||||||||||||||||||||||
| Gene product | cdc2-related protein kinase 1 | ||||||||||||||||||||||||
| Gene product: Alternative name | CRK-1 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid single cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||
| Restriction sites to linearize plasmid | PstI | ||||||||||||||||||||||||
| Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | A deletion construct containing 825 bp (202–1027) of the 1734-bp coding sequence was made. This DNA fragment contains the glycine-rich motif mediating ATP binding but not the HRD motif directly involved in catalysis of Pbcrk-1. Both sites are essential for a kinase to be functional. | ||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | CRK-1 is a family member of cyclin-dependent kinases (CDKs) and shows homology to yeast p34(cdc2), also called CDK1. CRK-1 of P. falciparum is predominantly expressed in gametocytes. Pbcrk-1, the P. berghei orthologue of Pfcrk-1, was amplified from P. berghei genomic DNA using primers based on the Plasmodium yoelii orthologue of pfcrk-1 (PlasmoDB)(primers ATGGAAAGAAATATAAAACGAAAG; TGAACGAAACATAATTGTATTTTG). A deletion construct containing 825 bp (202–1027) of the 1734-bp coding sequence was made. This DNA fragment contains the glycine-rich motif mediating ATP binding but not the HRD motif directly involved in catalysis of Pbcrk-1. Both sites are essential for a kinase to be functional. Four independent transfections using this construct were unsuccessful, suggesting that CRK-1 is essential for asexual blood stages. In contrast, an integration event at this locus that did not result in a loss-of-function of the pbcrk-1 gene was readily observed indicating that the locus can be targeted by genetic modification. See also RMgm-554 for unsuccessful attempts to disrupt PBANKA_071990 Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565). The gene is likely essential for asexual proliferation. After transfection with a KO vector a weak PCR signal diagnostic for integration was observed, indicating that integration does transiently occur but parasites with a disrupted locus do not persist. Cloning will be required to validate this interpretation for this gene. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
 Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||