RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-215
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1418300; Gene model (P.falciparum): PF3D7_1320000; Gene product: golgi protein 1 | rhoptry protein 2, putative (PRP2, putative rhoptry protein 2)
Name tag: EGFP
Phenotype Asexual bloodstage; Oocyst; Sporozoite;
Last modified: 25 September 2015, 17:43
  *RMgm-215
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number)
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherM. Tufet-Bayona, C.J. Janse, R.E. Sinden, B. Franke-Fayard
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center (LUMC)
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-215
Principal namePRP2-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stagePRP2-GFP is expressed in trophozoites as early as 8 hours after invasion. In these stages a diffuse, weak fluorescence signal is observed in cytoplasmic areas close to the nucleus. In mature trophozoites and immature schizonts, the fluorescence intensity increases progressively, but its distribution in the cytoplasm is unchanged. PRP2-GFP expression is observed in mature schizonts and merozoites. Merozoites showed a 'two-dot' staining pattern which is characteristic for a location in the two rhoptry-organelles.
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNo PRP2-GFP expression is observed in gametocytes and ookinetes. PRP2-GFP is expressed during early oocyst development (days 3–5), a weak fluorescence pervaded the entire cytoplasm. In maturing oocysts (days 10–12), the intensity of fluorescence increases and is restricted to the forming sporoblasts. In the mature oocysts containing sporozoites, fluorescence is present in all sporozoites as a single intense fluorescent dot posterior to the nuclei. Free sporozoites released from ruptured oocysts revealed a similar pattern of fluorescence.
SporozoiteIn the mature oocysts containing sporozoites, fluorescence is present in all sporozoites as a single intense fluorescent dot posterior to the nuclei. Free sporozoites released from ruptured oocysts revealed a similar pattern of fluorescence. Compared to oocyst-derived sporozoites, salivary gland sporozoites show a different distribution, two clear dots are observed at either side of the nucleus.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a c-terminal GFP-tagged PRP2 (putative rhoptry protein 2).

Protein (function)
PRP2 shows sequence homology with a putative rhoptry protein of Toxoplasma gondii (41.m01337; twinscan-2579). The T. gondii proteins has been detected in a proteomic analysis of purified rhoptries. See also 'Additional Information'.
Evidence has been presented that the P. falciparum ortholog (PF3D7_1320000) is NOT located in rhoptries but is localizes to the Golgi Apparatus (PMID 26375591). 

Phenotype
The phenotype analyses indicate expression of GFP-tagged PRP2 in rhoptries of merozoites.  PRP2 is also expressed in oocysts and sporozoites. However, the location of PRP2-GFP in sporozoites is not indicative of a rhoptry location (see also 'Additional information').

Additional information
PRP2-GFP is expressed in trophozoites as early as 8 hours after invasion. In these stages a diffuse, weak fluorescence signal is observed in cytoplasmic areas close to the nucleus. Such a localization is indicative of the localization in the ER and Golgi.
In salivary gland sporozoites two clear GFP-positive spots were observed at either side of the nucleus, which may suggest a localization of the tagged protein in both the ER and Golgi.

The GFP expression pattern of PRP2-GFP in sporozoites is clearly different from the fluorescence pattern of the GFP-tagged rhoptry protein RAP2/3 in sporozoites that shows an apical location (see RMgm-209). The location of PRP2 has only been analysed by fluorescence microscopy of the GFP-tagged PRP2. Determination of the exact location in both blood stages and in sporozoites awaits confirmation  by additional analyses, for example immuno-electron microscopy.

Evidence has been presented that the P. falciparum ortholog (PF3D7_1320000) is NOT located in rhoptries but is localizes to the Golgi Apparatus (PMID 26375591). 

Other mutants
RMgm-216: Unsuccessful attempts to disrupt the prp2 gene


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1418300
Gene Model P. falciparum ortholog PF3D7_1320000
Gene productgolgi protein 1 | rhoptry protein 2, putative
Gene product: Alternative namePRP2, putative rhoptry protein 2
Details of the genetic modification
Name of the tagEGFP
Details of taggingC-terminal
Additional remarks: taggingThe chosen integration strategy for the construct results in integration at the target locus by a single cross-over homologous recombination event.
Commercial source of tag-antibodies
Type of plasmid/construct(Linear) plasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid PacI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCGGATCCATGATTTCTTCTAAGTCAATAATATTATTAACAC
Additional information primer 1L1839 (BamHI); C-terminal region of the intact 3.8 kb prp2 sequence
Sequence Primer 2CATGCCATGGATTTTTCATCAAGTTGGA
Additional information primer 2L1839 (BamHI); C-terminal region of the intact 3.8 kb prp2 sequence
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6