Summary

RMgm-209
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1101400; Gene model (P.falciparum): PF3D7_0501600; Gene product: rhoptry-associated protein 2 (RAP2/3; rhoptry-associated protein 2/3)
Name tag: EGFP
Phenotype Asexual bloodstage; Oocyst; Sporozoite;
Last modified: 12 May 2009, 11:53
  *RMgm-209
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19428669
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherM. Tufet-Bayona, C.J. Janse, R.E. Sinden, B. Franke-Fayard
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center (LUMC)
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-209
Principal name452cl1
Alternative nameRAP2/3-GFP
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageAnalysis of GFP expression in synchronized asexual blood stage parasites in vitro showed GFP expression only in maturing schizonts, as merozoites are formed. Strong GFP expression was observed in the merozoites within the mature schizont. Merozoites showed a 'two-dot' staining pattern which is characteristic for location in the two rhoptry-organelles.
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystRAP2/3-GFP was not expressed in gametocytes, zygotes, ookinetes and developing oocysts, up to day 9 after mosquito infection and GFP expression only appeared in sporulating oocysts (from day 9 onwards). Both oocyst-derived sporozoites and salivary gland sporozoites showed clear patterns of GFP fluorescence. In oocyst-derived sporozoites GFP fluorescence appeared as 2–6, often clearly separated, dots on the apical side of the nucleus whereas in most (>80%) of the mature salivary gland sporozoites the GFP fluorescence was seen as a longer uniformly staining pattern beginning at the very apical end of the parasite.
SporozoiteBoth oocyst-derived sporozoites and salivary gland sporozoites showed clear patterns of GFP fluorescence. In oocyst-derived sporozoites GFP fluorescence appeared as 2–6, often clearly separated, dots on the apical side of the nucleus whereas in most (>80%) of the mature salivary gland sporozoites the GFP fluorescence was seen as a longer uniformly staining pattern beginning at the very apical end of the parasite
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a c-terminal GFP-tagged RAP2/3 (rhoptry-associated protein 2/3).

Protein (function)
In P. falciparum a low-molecular-weight protein complex, consisting of three non-covalently linked members, RAP1, RAP2 and RAP3 localises to the rhoptries of merozoites. RAP2 and RAP3 are encoded by adjacent genes (PFE0080c; PFE0075c), organised in a head to tail fashion on chromosome 5. Both rap2 and rap3 show a high homology with the single copy, syntenic gene, rap2/3 of P. berghei. The RAP proteins are implicated in the invasion of the erythrocyte by the merozoite.

Phenotype
The phenotype analyses indicate expression of GFP-tagged RAP2/3 in rhoptries of merozoites and rhoptries of the sporozoites. No expression was observed in ookinetes which is in agreement with the proposed lack of rhoptries in this third invasive form of Plasmodium.

Additional information
PFE0080c - rhoptry-associated protein 2, RAP2
PFE0075c - rhoptry-associated protein 3, RAP3
Gen Bank accession number P. berghei rap2/3: XM 669159.1

Other mutants
RMgm-211: Unsuccessful attempts to disrupt the rap2/3 gene


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1101400
Gene Model P. falciparum ortholog PF3D7_0501600
Gene productrhoptry-associated protein 2
Gene product: Alternative nameRAP2/3; rhoptry-associated protein 2/3
Details of the genetic modification
Name of the tagEGFP
Details of taggingC-terminal
Additional remarks: taggingThe chosen integration strategy for the construct results in integration at the target locus by a single cross-over homologous recombination event. Integration results in the introduction of the gfp gene downstream of rap2/3 together with 0.4 kb of the pbdhfr 3'UTR and the hdhfr selection cassette conferring resistance to the antimalarial drug pyrimethamine.
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
TGAATACAAAAATATTTATGTATTTTTTCGTTTCCCTTTTTCTATGTCATGTTGTTTATG
GAGATAAGTGCTCAATACCTCTTAAAGATATTAAATTTCAAAATTTTTCATTGTTTAATC
TGATTAAATCTCATGATGATACAGAAGGAAGATTAAGTACTTGGATTCATTTTTTTTTTA
ATAGAATTCATGACCCTTATTATGCTGGAAACTATATGAAACATTTTAATATAAATACTA
TAAATGTAGAAGATCAACCATGCTTTATAAGAGCATTTAATATATACATGATTCATACGC
ATGCTAATAAAATTCTAAGCGTAACAGAAAACGAAGAAAATAGTTTTCATAAAGATAAGT
ATTCAAGTATAAAAGACTATTTAAAAGATTTTTTCTGGGTAGCAGAAACAAAATCAGTTC
ATAAATACTTAGATGATTTATTATTGAATATTCATGAGATTGATAATGCAAAATTAGATC
TTAGTCTCATAAAAGATTTGGTAACAAAAGCGAGTGTAAACACCCCTGCAAAGTTTATAG
ATGATCCTATGAAAGCTTTAGAAAATATTAAACTAGTTGAAGAGGTTAATGATAAACGCA
TAGATGCTTCAAAACATGCTAGCCGTGATTACAAATTATTAGCTATATTAAGTTTAAAAA
ATCATTATTACAATGCAGATCTCACTCACCCCATACCAAGTGTTCGAGACGAAATTGATA
GTATGATACGCTTATGGTTCAGAAAGCGTAGTAAATTATTTCCTTTATATAAGAATCCTT
TAATTCTTGAAGATAATACTAGATGTAGTAAAACAAATCTAAAATGTTATCCAACCCCCG
ACGATTTGGTTCAAGCATTTTTTTCAGCTATTAAAGAAAAAATGTTAAAAATATACATAC
GATTTTTGGACAATTTTAGTATAGCAATACAAAATAAATCATATAAAATAGACGGATTAA
AAGGTATGAAATTTTTAAAAAGTCTTTTTCAAAGAAAAACCTTCCCAAATTTTGTAAAAT
TGAATTCTGATTACATATCATCCGAATTAATCTTCTTAAGAGAAAGTTTTTTTGATGCAC
TTGATAGTACTTTAAATTGTTACACCAATAAATATATGAATTTACCTGGTGATATATATT
TGGATACTAAGATGGTCGGCGCATCCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGG
TGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCG
GCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCG
GCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCT
TCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAG
GCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCG
AGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCA
AGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCT
ATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACA
TCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACG
GCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACC
CCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTC
TCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCGACTCTAGAAGATCCCGTTTTTCTT
ACTTATATATTTATACCAATTGATTGTATTTATAACTGTAAAAATGTGTATGTTGTGTGC
ATATTTTTTTTTGTGCATGCACATGCATGTAAATAGCTAAAATTATGAACATTTTATTTT
TTGTTCAGAAAAAAAAAACTTTACACACATAAAATGGCTAGTATGAATAGCCATATTTTA
TATAAATTAAATCCTATGAATTTATGACCATATTAAAAATTTAGATATTTATGGAACATA
ATATGTTTGAAACAATAAGACAAAATTATTATTATTATTATTATTTTTACTGTTATAATT
ATGTTGTCTCTTCAATGATTCATAAATAGTTGGACTTGATTTTTAAAATGTTTATAATAT
GATTAGCATAGTTAAATAAAAAAAGTTGAAAAATTAAAAAAAAACATATAAACACAAATG
ATGTTTTTTCCTTCAATTTCGGGTACCGAGCTCGAATTCAACCTGGTTGATCTTGCCAGT
AGTCATATGCTTGTCTCAAAGATTAAGCCATGCAAGTGAAAGTATATGCACATTTATTGC
AGAAACTGCGAACGGCTCATTAAAACAGTTATAATCTACTTGACATTTTATTATAAGGAT
AACTACGGAAAAGCTGTAGCTAATACTTGTTAAGTACTTTTACTCCCCGGAGTAATTGTA
TGTATTTGTTAAGACCCCTAAGAAAAAATGATATTAAAGGAATTATAACAAAGAAGCAAC
ACATAATATAATTATTCAGTGTGTATCAATCGAGTTTCTGACCTATCAGCTTTTGATGTT
AGGGTATTGACCTAACATGGCTTTGACGGGTAACGGGGAATTAGAGTTCGATTCCGGAGA
GGGAGCCTGAGAAATAGCTACCACATCTAAGGAAGGCAGCAGGCGCGTAAATTACCCAAT
TCTAAATAAGAGAGGTAGTGACAAGAAATAACAATATAAGGCCAAATTTTGGTTTTATAA
TTGGAATGATGGGAATTTAAAACCTTCCCAAAAATCAATTGGAGGGCAAGTCTGGTGCCA
GCAGCCGCGGTGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGC
CGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGC
AGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTC
CCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGC
GGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGC
TCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCT
AAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAA
ACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCC
TTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACT
CAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTG
GTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCT
TACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTC
TAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAA
TATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTT
GCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCT
GAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATC
CTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTA
TGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACAC
TATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGC
ATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAAC
TTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGG
GATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGAC
GAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGC
GAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTT
GCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGA
GCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCC
CGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAG
ATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCA
TATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATC
CTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA
GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGC
TGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTA
CCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTT
CTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTC
GCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGG
TTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCG
TGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAG
CTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGC
AGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTAT
AGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGG
GGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGC
TGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATT
ACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA
GTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCG
ATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAAC
GCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCG
GCTCGTATGTTGTGTGGAATTGTGAGCGGTAAACAATTTCACACAGGAAACAGCTTGACC
ATGATTACGCCAAGCTTGATAATTCCTGCAGCCCAGCTTAATTCTTTTCGAGCTCTTTAT
GCTTAAGTTTACAATTTAATATTCATACTTTAAGTATTTTTTGTAGTATCCTAGATATTG
TGCTTTAAATGCTCACCCCTCAAAGCACCAGTAATATTTTCATCCACTGAAATACCATTA
AATTTTCAAAAAAATACTATGCATATAATGTTATACATATAAACATAAAACGCCATGTAA
ATCAAAAAATATATAAAAATATGTATAAAAATAAATATGCACTAAATATAAGCTAATTAT
GCATAAAAATTAAAGTGCCCTTTATTAACTAGTCGTAATTATTTATATTTCTATGTTATA
AAAAAATCCTCATATAATAATATAATTAATATATGTAATGTTTTTTTTATTTTATAATTT
TAATATAAAATAATATGTAAATTAATTCAAAAAATAAATATAATTGTTGTGAAACAAAAA
ACGTAATTTTTTCATTTGCCTTCAAAATTTAAATTTATTTTAATATTTCCTAAAATATAT
ATACTTTGTGTATAAATATATAAAAATATATATTTGCTTATAAATAAATAAAAAATTTTA
TAAAACATAGGGGGATCTATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAAC
ATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAACGAATTTAGATAT
TTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGT
AAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTA
GTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTA
GATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGG
ATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTA
TTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTG
GAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAA
GGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAAAGATCCCGTTTTTCTTAC
TTATATATTTATACCAATTGATTGTATTTATAACTGTAAAAATGTGTATGTTGTGTGCAT
ATTTTTTTTTGTGCATGCACATGCATGTAAATAGCTAAAATTATGAACATTTTATTTTTT
GTTCAGAAAAAAAAAACTTTACACACATAAAATGGCTAGTATGAATAGCCATATTTTATA
TAAATTAAATCCTATGAATTTATGACCATATTAAAAATTTAGATATTTATGGAACATAAT
ATGTTTGAAACAATAAGACAAAATTATTATTATTATTATTATTTTTACTGTTATAATTAT
GTTGTCTCTTCAATGATTCATAAATAGTTGGACTTGATTTTTAAAATGTTTATAATATGA
TTAGCATAGTTAAATAAAAAAAGTTGAAAAATTAAAAAAAAACATATAAACACAAATGAT
GTTTTTTCCTTCAATTTCGATATCGAATTCCTGCAGCCCGGGGGATCCA
Restriction sites to linearize plasmid NheI
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGGATCCATGAATACAAAAATATTTATGTATTTTTTCG
Additional information primer 1L1731 complete rap2/3 coding sequence (BamHI)
Sequence Primer 2CATGCCATGGATGCGCCGACCATCTTAGTATCC
Additional information primer 2L1732 complete rap2/3 coding sequence (NcoI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6