Summary

RMgm-205
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0402200; Gene model (P.falciparum): PF3D7_0303600; Gene product: plasmoredoxin (Plrx; thioredoxin-like redox-active protein, putative)
PhenotypeNo phenotype has been described
Last modified: 23 March 2009, 11:54
  *RMgm-205
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18575607
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherK. Buchholz, K. Becker, K. Matuschewski
Name Group/DepartmentInterdisciplinary Research Centre
Name InstituteJustus-Liebig University
CityGiessen
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-205
Principal namePlrx(-)Rep
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Plasmoredoxin (Plrx).

Protein (function)
Malaria parasites possess-in addition to the classical thioredoxins-a Plasmodium-specific member of the thioredoxin superfamily termed plasmoredoxin (Plrx). Plrx is a 22 kDa dithiol protein with the unique active site sequence WCKYC (see further 'Additional information').

Phenotype
The phenotype analyses indicate a non-essential role of Plrx during blood stage development, mosquito development and development in the liver under normal growth conditions (see also 'Additional information').

Additional information
To determine whether loss of Plrx expression affects parasite growth under redox stress conditions, an in vitro culture assay over 24 hours was performed to determine the IC50 values in wild type and mutant parasites upon exposure to antimalarial drugs, some of which act also as elicitors of redox stress. The compounds tested included 4-aminoquinolines, i.e. chloroquine and amodiaquine, methylene blue, mefloquine, and artemisinin. In order to minimize stage-specific effects non-synchronized asexual blood stages were used. Notably, the IC50 values of the mutant parasites did not differ significantly from wild type parasites, excluding, at least ex vivo, a central function of Plrx in anti-redox stress defence.
The absence of Plrx expression induces only weak changes in blood stages of transcript levels of selected redox proteins, thioredoxin reductase (TrxR) and glutathione reductase (GR) as shown by qRT-PCR experiments.

In most eukaryotic organisms, redox-active enzymes, such as catalase, superoxide dismutase, and peroxidases as well as an enzymatic cascade that generates reduced electron donors, i.e. glutathione (GSH) and thioredoxin (Trx), sustain the cellular redox homeostasis. This redox network is split into two major arms, the GSH and the Trx system, that serve complementary functions in antioxidant defence and DNA synthesis. The malarial parasite Plasmodium lacks two central antioxidant enzymes: (i) catalase that typically detoxifies hydrogen peroxide and (ii) a classical glutathione peroxidase, a selenoenyzme that reduces lipid hydroperoxides to their alcohols. This apparent deficiency  underscores the central importance of the thioredoxin system in the parasite. In good agreement, Trx reductase, which transfers electrons from NADPH to Trx, appears to perform vital functions for asexual development of the malaria parasite in vitro. Malaria parasites possess-in addition to the classical thioredoxins, a Plasmodium-specific member of the thioredoxin superfamily termed plasmoredoxin (Plrx). Plrx is a 22 kDa dithiol protein with the unique active site sequence WCKYC. Plrx is not reduced by thioredoxin reductase but can react with glutaredoxin and glutathione.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0402200
Gene Model P. falciparum ortholog PF3D7_0303600
Gene productplasmoredoxin
Gene product: Alternative namePlrx; thioredoxin-like redox-active protein, putative
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCCAGCATTGATAACAGTATGAACAACAGC
Additional information primer 1PbRep1 for (KpnI); 5'
Sequence Primer 2CCCAAGCTTTACGAAGAACTTAACAAAGCTCATCG
Additional information primer 2PbRep1 rev (HindIII); 5'
Sequence Primer 3GGACTAGTGTTATGTTGTTGCATCCTAAACCTCAAAC
Additional information primer 3PbRep2 for (SpeI); 3'
Sequence Primer 4TCCCCGCGGCTCGTTGGATGATTTTGAAATTGCC
Additional information primer 4PbRep2 rev (SacII); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6