RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-203
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1128100; Gene model (P.falciparum): PF3D7_0629300; Gene product: phosphatidylcholine-sterol acyltransferase, putative | phospholipase, putative (PL, phospholipase; UIS10)
Details mutation: Mutation of the PL putative catalytic site (S495A, D700A and H728A)
Phenotype Sporozoite; Liver stage;
Last modified: 4 March 2010, 23:43
  *RMgm-203
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 15590623
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherP. Bhanot; V. Nussenzweig
Name Group/DepartmentDepartment of Pathology
Name InstituteNew York University School of Medicine
CityNew York
CountryUSA
top of page
Name of the mutant parasite
RMgm numberRMgm-203
Principal namepl mut
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of salivary gland sporozoites are formed that show normal gliding motility. Mutant sporozoites show an in vitro invasion rate of HepG2 cells and development within the hepatocytes that is comparable to wild type parasites.
When infected by mosquito bite, the mutant parasites were detected in blood 1 day later than wild type parasites, indicating a 90% reduction in the infectivity of the sporozoites.
Liver stageMutant sporozoites show an in vitro invasion rate of HepG2 cells and development within the hepatocytes that is comparable to wild type parasites.
When infected by mosquito bite, the mutant parasites were detected in blood 1 day later than wild type parasites, indicating a 90% reduction in the infectivity of the sporozoites.
Additional remarks phenotype

Mutant/mutation
The mutant expresses a mutated form of phosphatidylcholine-sterol acyltransferase precursor, putative (PL, phospholipase). The PL putative catalytic site is mutated (S495A, D700A and H728A). See also mutant RMgm-202 lacking expression of PL.

Protein (function)
PL contains a motif characteristic of lipases and a catalytic triad of a serine, aspartate, and histidine that is found in several phospholipases. PL is located on the surface of sporozoites.

Phenotype
During an infection through mosquito bite, the infectivity of the mutant parasites in the liver is decreased by 90%. See also the phenotype analysis of a mutant (RMgm-202) lacking expression of PL. Sporozoites of this mutant are impaired in their ability to cross epithelial cell layers in vitro. The combined analyses indicate that PL functions as a lipase to damage cell membranes (by hydrolysing phosphatidylcholine and possibly other phospholipids) and facilitates sporozoite passage through cells during their migration from the skin to the bloodstream.

Additional information
Lipase and membrane lytic activity of LP in vitro was shown using recombinant baculovirus-expressed protein.

PL (previously termed UIS10) was identified in a subtractive hybridization screen for genes expressed preferentially in P. berghei salivary gland sporozoites.

Other mutants
RMgm-202: A mutant lacking expression of PL

  Mutated: Mutant parasite with a mutated gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1128100
Gene Model P. falciparum ortholog PF3D7_0629300
Gene productphosphatidylcholine-sterol acyltransferase, putative | phospholipase, putative
Gene product: Alternative namePL, phospholipase; UIS10
top of page
Details of the genetic modification
Short description of the mutationMutation of the PL putative catalytic site (S495A, D700A and H728A)
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid AflII
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe modified locus contains two copies of the pl locus. The first copy, under the control of the endogenous regulatory 5'-untranslated region of pl, expresses full-length protein whose active site has been mutated. The second copy is not expressed, since it is missing the 5'-untranslated region and contains a stop codon at the 5'-end
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATAAGAATGCGGCCGCTTAATTAGTTGTATTTTTATCTATG
Additional information primer 1Full length pl (NotI)
Sequence Primer 2AACTAGTATGCAAGCATTTCTCTTTATAATCATATTATATAACTGGATATGTTTGGCGTTAATT
Additional information primer 2Full length pl (SpeI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren