Summary

RMgm-202
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1128100; Gene model (P.falciparum): PF3D7_0629300; Gene product: phosphatidylcholine-sterol acyltransferase, putative | phospholipase, putative (PL, phospholipase; UIS10)
Phenotype Sporozoite; Liver stage;
Last modified: 13 March 2009, 20:38
  *RMgm-202
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 15590623
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherP. Bhanot; V. Nussenzweig
Name Group/DepartmentDepartment of Pathology
Name InstituteNew York University School of Medicine
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-202
Principal namepl ko
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of salivary gland sporozoites are formed that show normal gliding motility. Mutant sporozoites show an in vitro invasion rate of HepG2 cells and development within the hepatocytes that is comparable to wild type parasites.
When infected by mosquito bite, the mutant parasites were detected in blood 1 day later than wild type parasites. In contrast to a bite infection, there was no difference in the prepatent period of mutant and wild type parasites when the rats were infected by intravenous injection, indicating a 90% reduction in the infectivity of the sporozoites. By real time PCR a decrease of 90% in parasite load in the liver was detected in mice infected with the mutant parasites by mosquito bite compared to mice infected with wild type parasites.
Liver stageMutant sporozoites show an in vitro invasion rate of HepG2 cells and development within the hepatocytes that is comparable to wild type parasites.
When infected by mosquito bite, the mutant parasites were detected in blood 1 day later than wild type parasites, indicating a 90% reduction in the infectivity of the sporozoites. In contrast to a bite infection, there was no difference in the prepatent period of mutant and wild type parasites when the rats were infected by intravenous injection. By real time PCR a decrease of 90% in parasite load in the liver was detected in mice infected with the mutant parasites by mosquito bite compared to mice infected with wild type parasites.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of phosphatidylcholine-sterol acyltransferase precursor, putative (PL, phospholipase).

Protein (function)
PL contains a motif characteristic of lipases and a catalytic triad of a serine, aspartate, and histidine that is found in several phospholipases. PL is located on the surface of sporozoites.

Phenotype
During an infection through mosquito bite, the infectivity of the mutant parasites in the liver is decreased by 90%. The prepatent period of the resulting blood infection is 1 day longer as compared with wild type. The mutant sporozoites are impaired in their ability to cross epithelial cell layers in vitro. These analyses indicate that PL functions as a lipase to damage cell membranes (by hydrolysing phosphatidylcholine and possibly other phospholipids) and facilitates sporozoite passage through cells during their migration from the skin to the bloodstream.

Additional information
Lipase and membrane lytic activity of LP in vitro was shown using recombinant baculovirus-expressed protein.

To test the cell traversal capacity of sporozoites an assay was used in which sporozoites have to traverse an epithelial cell barrier formed by a confluent monolayer of Mardin-Darby canine kidney (MDCK) cells. MDCK cells are plated in the top chamber of a Transwell filter system, whereas HepG2 cells are plated in the bottom chamber. Sporozoites are then added to the top chamber. Since confluent MDCK cells form very tight intercellular junctions, the number of EEFs formed in the HepG2 cell layer is proportional to the numbers of sporozoites that are able to traverse through the MDCK cell layer and is a reflection of the ability of sporozoites to cross cell barriers. Mutant sporozoites formed about 90% fewer EEFs compared with wild type sporozoites, suggesting that they are impaired in their ability to traverse cell layers.

PL (previously termed UIS10) was identified in a subtractive hybridization screen for genes expressed preferentially in P. berghei salivary gland sporozoites.

Other mutants
RMgm-203: A mutant expressing a mutated version of PL


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1128100
Gene Model P. falciparum ortholog PF3D7_0629300
Gene productphosphatidylcholine-sterol acyltransferase, putative | phospholipase, putative
Gene product: Alternative namePL, phospholipase; UIS10
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/SacII
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Integration of the targeting plasmid causes reduction in size of a 2.5-kb fragment in wild type parasites to a 0.5-kb fragment in the mutant parasites. There is complete loss of PL transcripts in the mutant parasites
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationWild type pl was replaced by a tgdhfr/ts-gfp selection cassette.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CTCGAGATAAGGCATGCAAAAAAACAC
Additional information primer 1(XhoI); 5'
Sequence Primer 2CTCGAGCATTCGAAAAATTACCCGTTCC
Additional information primer 2(XhoI); 5'
Sequence Primer 3GGATCCTTAATGTACCATTTGCTGG
Additional information primer 3(BamHI); 3'
Sequence Primer 4ACTAGTGAATAAAGTGCGTATCTTGG
Additional information primer 4(SpeI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6