Summary

RMgm-197
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1229800; Gene model (P.falciparum): PF3D7_0615100; Gene product: enoyl-acyl carrier reductase (FABI)
Phenotype Sporozoite; Liver stage;
Last modified: 31 August 2015, 12:38
  *RMgm-197
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19064257
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherM. Yu; D.A. Fidock
Name Group/DepartmentDepartment of Microbiology
Name InstituteColumbia University
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-197
Principal name∆fabI
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of salivary gland sporozoites are formed. Sporozoites have a strongly reduced infectivity to mice as shown by a significant delay of blood infections after intravenous inoculation of sporozoites.
Liver stageNormal numbers of salivary gland sporozoites are formed. Sporozoites have a strongly reduced infectivity to mice as shown by a significant delay of blood infections after intravenous inoculation of sporozoites. Sporozoites showed normal cell traversal, hepatocyte invasion rates and initial stages of intrahepatic development. The formation of merozoites within the liver schizonts was strongly affected. Abnormal progression of nuclear division became apparent. 99.5% of the schizonts was MSP1 negative. No mature merozoites were formed and released.

Injection of 1000 Pb∆fabI SPZs produced a blood-stage infection in only 5/16 mice, with the infected mice showing a delay in patency of 4 days. Increasing the Pb∆fabI inoculum to 10,000 SPZs resulted in patent infections in 13/15 mice, with those mice again showing an average delay of 4 days compared to controls.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of FABI

Protein (function)
FABI is an enzyme of the bacterial like type II fatty acid biosynthesis (FAS-II) pathway. In Plasmodium FAS-II enzymes have been localized to the apicoplast, a nonphotosynthetic plastid organelle of cyanobacterial origin.
FAS-II requires acetyl-Coenzyme A (CoA), which can be converted from pyruvate by the pyruvate dehydrogenase complex. Acetyl-CoA carboxylase converts acetyl-CoA to malonyl-CoA, which is tethered to an acyl carrier protein (ACP) by malonyl-CoA:ACP transacylase (FabD). This produces malonyl-ACP, which, in conjunction with acetyl-CoA, is acted upon by β-ketoacyl-ACP synthase III (Fab H) to form β-ketoacyl-ACP. This precursor enters the FAS-II elongation cycle, mediated by FabB/F (β-ketoacyl-acyl-carrier-protein (ACP) synthase), FabG (β-ketoacyl-ACP reductase), FabZ/A (β-hydroxyacyl-ACP dehydratase), and FabI (trans-2-enoyl-ACP reductase). These four FAS-II enzymes iteratively catalyze the addition of two carbon chains to a growing fatty acyl carbon chain via condensation, reduction, dehydration, and reduction steps, respectively.

Phenotype
The phenotype analyses show that FABI is not essential for blood stage development, mosquito stage development and initial infection of the liver. The results indicate a key role of FABI in the formation of infective liver stage merozoites demonstrating the importance of FASII pathway for synthesis of fatty acids during late liver stage development. See also Additional Information below.

Additional information
Drug-susceptibility assays showed that blood stages of mutant and wild type parasites had the same sensitivity to triclosan, indicating that FABI is not the target of triclosan.

Mutant blood stages produced fatty acids, indicating that FABI is not required for fatty acid synthesis in the blood stage parasites.

Injection of 1000 Pb∆fabI SPZs produced a blood-stage infection in only 5/16 mice, with the infected mice showing a delay in patency of 4 days. Increasing the Pb∆fabI inoculum to 10,000 SPZs resulted in patent infections in 13/15 mice, with those mice again showing an average delay of 4 days compared to controls. The data demonstrate that P. berghei parasites lacking FabI produce SPZs that are highly attenuated in their infectivity to the mammalian host.

A second control mutant, PbfabIRec, was generated in which the endogenous fabI coding region was replaced with the full length fabI gene along with the tgdhfr-ts selectable marker. The 1.3 kb full-length fabI gene was amplified using primers Mp13 and Mp14 (CCAGATCTATTGTTAATAGAATTTTTATTGAATATATTC and CCGCGCGCGAATAGAGTGAGAAAGAGAATGAAAGG respectively.

Other mutants
RMgm-180: A mutant expressing myc tagged FABI
RMgm-181: A mutant expressing myc tagged FABZ
RMgm-182: A mutant expressing myc tagged FABG
RMgm-184: A mutant lacking expression of FABZ
RMgm-183: A mutant lacking expression of FABB/F


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1229800
Gene Model P. falciparum ortholog PF3D7_0615100
Gene productenoyl-acyl carrier reductase
Gene product: Alternative nameFABI
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SnaBI/AhdI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CTTACTAGTGTTCAGAAGAAAAATACAAATAAGGTGG
Additional information primer 1MP8 (SpeI) pbfabI 5' UTR (F)
Sequence Primer 2CTTAGATCTCTATTAACAATAATATTGTTTACTATTTTCG
Additional information primer 2MP9 (BglII) pbfabI 5' UTR (R)
Sequence Primer 3CTTGGTACCCCTTTCATTCTCTTTCTCACTCTATTC
Additional information primer 3MP10 (KpnI) pbfabI 3' UTR (F)
Sequence Primer 4CTTAGGCCTTTTAAACTTTCTCATTTCCAATTAACTGC
Additional information primer 4MP11 (StuI) pbfabI 3' UTR (R)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6