top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_0502600
|
Gene Model P. falciparum ortholog |
PF3D7_1018300
|
Gene product | conserved Plasmodium protein, unknown function |
Gene product: Alternative name | |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct used | Plasmid double cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
KpnI/SacII
|
Partial or complete disruption of the gene | Complete |
Additional remarks partial/complete disruption |
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The gene has been identified in a study to identify proteins that are exported from the blood stage parasite to the host erythrocyte and that are conserved between P. falciparum and P. berghei. These proteins contain signal sequences and the Host-Targeting (HT) motif (van Ooij et al., 2008, PloS Pathogens 4, e10000084). Eleven conserved proteins were identified and 9 genes encoding these proteins were targeted for gene disruption in P. berghei. All attempts to disrupt these genes were unsuccessful, indication the essential nature of their proteins for blood stage development.
Two gene models are available: PB00147.00.0 and PB001168.00.0
Name of the transfection attempts experiments (Leiden Malaria Research Group): 712.5; 719.3 |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | aaaaagcaggctccgcgggtcttgtatttttccttttaaccaagtgg |
Additional information primer 1 | PB001047.00.0 upstream (SacII) |
Sequence Primer 2 | agaaagctgggtactagtcacatatattatatactaggattgttggccttatcctg |
Additional information primer 2 | PB001047.00.0 upstream (SpeI) |
Sequence Primer 3 | aaaaagcaggctaagcttctgttcgtactgcaaaaatatcatctcgc |
Additional information primer 3 | PB001047.00.0 downstream (HindIII) |
Sequence Primer 4 | agaaagctgggtggtaccatcacacccatttcctacatgtattcatattaattcg |
Additional information primer 4 | PB001047.00.0 downstream (KpnI) |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
top of page |