Summary

RMgm-175
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1ab, elongation factor 1 alpha b)
Phenotype Asexual bloodstage;
Last modified: 9 March 2009, 19:22
  *RMgm-175
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 14651637
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherC.J. Janse; A. Haghparast; A.P. Waters
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center (LUMC)
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-175
Principal name145cl2; 145cl4
Alternative nameeef1ab-; A-KO2
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageMutants show a small decrease in the proliferation rate in mice compared to wild type blood stages.
The growth phase of the asexual blood stages is extended by up to 20%. Analysis of the cell cycle by flow cytometry as well as transcriptional analyses revealed that the duration of the S and M phases during schizogony and the number of daughter merozoites per schizont were not detectably affected, but that the G1 phase (development of the ring form into the mature trophozoite) is elongated.
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant contains a disrupted eefiab gene which is one of the two copies that are present in the genome (eefiaa and eefiab) and which encode the protein (eukaryotic) elongation factor 1 alpha (eEF1A). The disruption results in reduced production of eEF1A.
Plasmodium contain two eef1a genes with identical open reading frames linked head-to-head in the genome separated by a short 1 kb region (bidirectional promoter region) that drives the transcription of both genes. This mutant exhibited an unpredicted integration event. The eef1ab gene is disrupted, but these parasites contain an intergenic region that is inverted compared with the arrangement of the pbeef1a intergenic region of wt parasites (see also mutant 174 which also contains a disrupted eef1ab gene but with a normal organization of the intergenic region).

Protein (function)
Eukaryotic elongation factor 1A (eEF1A) is a highly abundant multifunctional protein that regulates components of protein synthesis and cell growth and is principally responsible for the transfer of amino-acylated tRNA to the ribosome A site. Plasmodium contain two eef1a genes with identical open reading frames linked head-to-head in the genome separated by a short 1 kb region (bidirectional promoter region) that drives the transcription of both genes.

Phenotype
The disruption of the eef1ab gene results in reduced production of eEF1A. Mutants can complete the vertebrate and mosquito phases of the life cycle, but  the blood stages of mutants show a small decrease in the proliferation rate in mice compared to wild type blood stages. The growth phase of the asexual blood stages is extended by up to 20%. Analysis of the cell cycle by flow cytometry as well as transcriptional analyses revealed that the duration of the S and M phases during schizogony and the number of daughter merozoites per schizont were not detectably affected, but that the G1 phase (development of the ring form into the mature trophozoite) is elongated.
Despite the lower proliferation rate of blood stages, the mutant parasites do induce cerebral complications in mice that are sensitive to experimental cerebral malaria (ECM).

Additional information
Mutants can complete the vertebrate and mosquito phases of the life cycle. However, possible (minor) effects of disruption of the eef1ab gene on (the cell cycle of) oocysts and liver stages have not been analysed in detail

Other mutants
RMgm-173: A mutant with disruption of the second copy of the eef1a gene, eef1aa
RMgm-174: An independent mutant with disruption of the eef1ab (without the inversion of the promoter region).


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1ab, elongation factor 1 alpha b
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid BamHI/EcoRI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption eef1ab was disrupted by inserting the Tgdhfr selectable marker into the ORF replacing 151 bp of its central coding region. eef1a promoter and eef1aa remained intact.
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThis mutant exhibited an unpredicted integration event. The eef1ab gene is disrupted, but these parasites contain an intergenic region that is inverted compared with the arrangement of the pbeef1a intergenic region of wt parasites (see also mutant 174 which also contains a disrupted eef1ab gene but with a normal organization of the intergenic region).
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCAAGCTTGGATCCACTAGTATGGGAAAAGAAAAAACTCAC
Additional information primer 1L402 (HindIII,BamHI,SpeI); Pbef-1α 5' end ORF
Sequence Primer 2CCCAAGCTTACTAGTCGGCTTGATATCCTACC
Additional information primer 2L403 (HIII, SpeI); Pbef-1α 5' end ORF
Sequence Primer 3GGATATCTTCCATTACAAGGTGTAT
Additional information primer 3L404 (EcoRV); Pbef-1α 3' end ORF
Sequence Primer 4GGGGTACCGCTGGTGCTTTAGCTGAG
Additional information primer 4L405 (KpnI); Pbef-1α 3' end ORF
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6