RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-162
Malaria parasiteP. yoelii
Genotype
DisruptedGene model (rodent): PY17X_0713100; Gene model (P.falciparum): PF3D7_0817900; Gene product: high mobility group protein B2 (HMGB2, high mobility group protein 2)
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete; Oocyst;
Last modified: 1 December 2013, 10:11
  *RMgm-162
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18400754
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii YM
Name parent line/clone P. yoellii YM lethal strain
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherM. Gissot; K. Kim
Name Group/DepartmentDepartments of Medicine and of Microbiology and Immunology
Name InstituteAlbert Einstein College of Medicine
CityNew York
CountryUSA
top of page
Name of the mutant parasite
RMgm numberRMgm-162
Principal name∆hmgb2 (clones B3, D1)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageA slight growth delay of the asexual blood stages, resulting in a 'delay in the onset of parasitemia'.
Gametocyte/GameteNormal gametocyte production (as determined by counting mature gametocytes in Giemsa stained slides). Normal exflagellation of male gametocytes.
Fertilization and ookineteReduction of in vitro ookinete production (52-61% compared to wild type).
Oocystthe mean number of oocysts in mutant infected mosquito was ~10% of the mean oocyst number seen in wild type infected mosquitoes. The mutant oocysts produced viable sporozoites that were infectious to mice.
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of HMGB2 (high mobility group protein 2).
(gene model in P. yoelii YM: PYYM_0713000)

Protein (function)
HMGB2  is a small protein containing a characteristic HMG box domain closely related to box B of metazoan HMG proteins. In other organisms it has been shown that HMGB proteins bind to DNA in a non-sequence specific fashion, influencing accesibility of chromatin and transcripion. During blood stage development HMGB2 is expressed in both asexual stages and gametocytes, with higher levels of transcripts in gametocytes.

Phenotype
HMGB2 is not essential for asexual blood stage development. The lack of expression of HMGB2 reduces both ookinete and oocyst production.

Additional information
By micro-array analysis evidence is found for downregulation of expression of genes in mutant gametocytes compared to wild type gametocytes, indicating a possible role of HMGB2 in regulation of transription in gametocytes.
(P. berghei gene models: PB001601.02.0, PB300353.00.0)

Other mutants

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PY17X_0713100
Gene Model P. falciparum ortholog PF3D7_0817900
Gene producthigh mobility group protein B2
Gene product: Alternative nameHMGB2, high mobility group protein 2
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SpeI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Disruption of the pyhmgb2 locus was performed after integration of a plasmid containing a segment of the pyhmgb2 gene and the selectable marker cassette Pbdhfr-ts fused to the gfp gene. The integration of this plasmid at the pyhmgb2 locus created two copies of the truncated gene after a single crossover event.
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationDisruption of the pyhmgb2 locus was performed after integration of a plasmid containing a segment of the pyhmgb2 gene and the selectable marker cassette Pbdhfr-ts fused to the gfp gene. The integration of this plasmid at the pyhmgb2 locus created two copies of the truncated gene after a single crossover event.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ggatccATTACATGTTATGATCTTCTAC
Additional information primer 1pyhmgb2 targeting region (BamHI)
Sequence Primer 2gcggccgcCAATGCTCTCTTTGGAGCTAATG
Additional information primer 2pyhmgb2 targeting region (NotI)
Sequence Primer 3TACAACTTTAGAACAAGACTAGTACTGTTTTGAAACAACTCA
Additional information primer 3An SpeI restriction site was created by site-directed mutagenesis at nucleotide position 258 of the cloned fragment using this primer
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren