top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PY17X_0713100
|
Gene Model P. falciparum ortholog |
PF3D7_0817900
|
Gene product | high mobility group protein B2 |
Gene product: Alternative name | HMGB2, high mobility group protein 2 |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct used | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
SpeI
|
Partial or complete disruption of the gene | Partial |
Additional remarks partial/complete disruption |
Disruption of the pyhmgb2 locus was performed after integration of a plasmid containing a segment of the pyhmgb2 gene and the selectable marker cassette Pbdhfr-ts fused to the gfp gene. The integration of this plasmid at the pyhmgb2 locus created two copies of the truncated gene after a single crossover event.
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | Disruption of the pyhmgb2 locus was performed after integration of a plasmid containing a segment of the pyhmgb2 gene and the selectable marker cassette Pbdhfr-ts fused to the gfp gene. The integration of this plasmid at the pyhmgb2 locus created two copies of the truncated gene after a single crossover event. |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences ![Click to view information Click to view information](includes/css/img/btn_show.gif)
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | ggatccATTACATGTTATGATCTTCTAC |
Additional information primer 1 | pyhmgb2 targeting region (BamHI) |
Sequence Primer 2 | gcggccgcCAATGCTCTCTTTGGAGCTAATG |
Additional information primer 2 | pyhmgb2 targeting region (NotI) |
Sequence Primer 3 | TACAACTTTAGAACAAGACTAGTACTGTTTTGAAACAACTCA |
Additional information primer 3 | An SpeI restriction site was created by site-directed mutagenesis at nucleotide position 258 of the cloned fragment using this primer |
Sequence Primer 4 | |
Additional information primer 4 | |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
top of page |