Summary

RMgm-153
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1131400; Gene model (P.falciparum): PF3D7_1354800; Gene product: metacaspase 1 (MC1, metacaspase 1)
Transgene
Transgene not Plasmodium: EGFP
Promoter: Gene model: PBANKA_1131400; Gene model (P.falciparum): PF3D7_1354800; Gene product: metacaspase 1 (MC1, metacaspase 1)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_1131400; Gene product: metacaspase 1 (MC1, metacaspase 1)
PhenotypeNo phenotype has been described
Last modified: 18 February 2009, 14:57
  *RMgm-153
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 17335919
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherL.L. Chat; R.E. Sinden; J.T. Dessens
Name Group/DepartmentDepartment of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene and Tropical Medicine
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-153
Principal nameMC1-KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of MC1 (metacaspase1) and expresses GFP under the control of the mc1 promoter.

Protein (function)
The MC1 protein belongs to a small 'family' of conserved genes which contain a Peptidase_C14/Caspase domain and has been identidied as a metacaspase. Caspases are cysteine proteases belonging to the Peptidase_C14 family (clan CD) with a so called Caspase Hemoglobinase Fold (CHF). Caspases are well known to play a role in apoptosis. Metacaspases are predicted CHF proteases, with paracaspases make up the caspase super-family. Metacaspases have thus far only been identified in organisms that do not possess classic caspase genes.

Phenotype
Phenotype analyses indicate a non-essential (redundant?) function of MC1 during the complete life cycle.
Analyses of GFP expression show lack of expression in asexual blood stages and male gametocytes. Female gametocytes, ookinetes, oocysts and sporozoites are GFP positive, indicating expression of MC1 in these stages.

Additional information
It has been reported that, in P. berghei, a large proportion of ookinetes undergo cell death, displaying typical apoptosis-like features such as PS translocation, nuclear condensation and DNA fragmentation. In this study apoptosis in ookinetes was studied using the following assays: Phosphatidylserine (PS) translocation was studied with fluorescein isothiocyanate (FITC)-conjugated Annexin V in conjunction with propidium iodide, by using the Annexin-FITC Apoptosis Detection Kit (Sigma–Aldrich) according to manufacturer's instructions. DNA condensation in the nucleus was assessed using acridine orange staining. DNA fragmentation was assessed by in situ terminal deoxynucleotidyl transferase mediated dUTP-biotin nick end labelling (TUNEL), by using the ApopTag® Fluorescein In Situ Apoptosis Detection Kit (Chemicon International) according to manufacturer's instructions. Caspase activation was assessed with sulphorhodamine-VAD-FMK inhibitor of caspases, by using the CaspaTag™ Pan-Caspase In Situ Assay Kit Chemicon International) according to manufacturer's instructions. The results from these apoptosis assays indicated that apoptosis-like death in ookinetes is low under the conditions tested and not significantly different between wild type and mutant ookinetes.
 
Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1131400
Gene Model P. falciparum ortholog PF3D7_1354800
Gene productmetacaspase 1
Gene product: Alternative nameMC1, metacaspase 1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/NotI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption The construct used to disrupt mc1 contains the egfp gene as a reporter. The disruption of mc1 results in the introduction of egfp under the control of the mc1 promoter.
egfp was introduced downstream of the first 11 codons of PbMCI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe construct used to disrupt mc1 contains the egfp gene as a reporter. The disruption of mc1 results in the introduction of egfp under the control of the mc1 promoter.
egfp was introduced downstream of the first 11 codons of PbMCI
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ACGAAGTTATCAGTCGACGGTACCCCATCATAAAGCAAAAAGC
Additional information primer 1pDNR-ΔMC-F; 5'
Sequence Primer 2ATGAGGGCCCCTAAGCTTATTTAACATAAATTTTGTCCATTT
Additional information primer 2pDNR-ΔMC-R; 5'
Sequence Primer 3TAAACCATTGGTCATACCAAAAAATAATCAAAAAAATAACCAA
Additional information primer 3IF-MC3′-F
Sequence Primer 4CGGGCCGCTCTAGCATGACCAGGCTCAATAATTGAACA
Additional information primer 4IF-MC3′-R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameEGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe construct used to disrupt mc1 contains the egfp gene as a reporter. The disruption of mc1 results in the introduction of egfp under the control of the mc1 promoter.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1131400
Gene Model P. falciparum ortholog PF3D7_1354800
Gene productmetacaspase 1
Gene product: Alternative nameMC1, metacaspase 1
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_1131400
Gene productmetacaspase 1
Gene product: Alternative nameMC1, metacaspase 1
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4