Back to search resultsSummaryRMgm-1510
|
||||||||||
*RMgm-1510| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene mutation, Introduction of a transgene |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 27425827 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | Not applicable |
| Other information parent line | |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Govindasamy K; Brochet, M; Billker, O; Bhanot, P |
| Name Group/Department | Department of Microbiology and Molecular Genetics, University of Medicine and Dentistry of New Jerse |
| Name Institute | Rutgers New Jersey Medical School, Rutgers, The State University of New Jersey |
| City | Newark, New Jersey |
| Country | USA |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-1510 |
| Principal name | CDPK4 cKO |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not tested |
| Gametocyte/Gamete | Not tested |
| Fertilization and ookinete | Not tested |
| Oocyst | Not tested |
| Sporozoite | Normal numbers of sporozoites in salivary glands. Reduced (2x) invasion of hepatocytes in vitro. |
| Liver stage | Reduced (2x) invasion of hepatocytes in vitro. No defect in development of liver stages and formation of merosomes. |
| Additional remarks phenotype | Mutant/mutation This mutant has been generated by replacement of the endogenous cdpk4 gene by an cdpk4 gene with a FRTed ORF in the mutant RMgm-747 that expresses FlpL. This mutant expresses the yeast FlpL recombinase under the control of the promoter of trap and does not contain a selectable marker. The flpl gene is integrated into the silent 230p locus by double cross-over integration. The cdpk4 ORF is removed from the genome by using the Flp/FRT site-specific recombination (SSR) system (see RMgm-269, RMgm-747). Removal of the FRTed ORF of cdpk4 has been achieved by transmission of the mutant through mosquitoes, thereby activating expression of the FlpL recombinase in sporozoites that resulted in the excision of the ORF of cdpk4 which was flanked by FRT sequences. Normal numbers of sporozoites in salivary glands. Reduced (2x) invasion of hepatocytes in vitro. No defect in development of liver stages and formation of merosomes. |
Mutated: Mutant parasite with a mutated gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0615200 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0717500 | ||||||||||||||||||||||||||
| Gene product | calcium-dependent protein kinase 4 | ||||||||||||||||||||||||||
| Gene product: Alternative name | cdpk4 | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Short description of the mutation | The mutant contains a FRTed ORF of the cdpk4 locus | ||||||||||||||||||||||||||
| Inducable system used | Flp/FRT | ||||||||||||||||||||||||||
| Short description of the conditional mutagenesis | The ORF of cdpk4 is removed in the sporozoite stage by the Flp/FRT system | ||||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | The CDPK4 cKO targeting vector was constructed by cloning (In-Fusion, Clontech) three PCR products into a vector that carries two FRT sites and the human dihydrofolate reductase expression cassette. Primers CTTGCATGCGCGGCCGCGTCTTTTACCATTTCTACAAT and TCGCCCTTATGCGGCCGCCTTTAACTTTCCTATATTTTATGC were used to amplify an approximately 1.0 kB fragment upstream of the 5’UTR of PbCDPK4 (PBANKA_0615200). The product was cloned into the vector linearized with NotI. Primers TAGGAACTTCCTCGAGTACATATGTTCATATTAAGAAA and CTGGGCTGCACTCGAGAATAAATGAGTATTTAAAATATATAGG were used to amplify a 2.6 kB fragment encompassing the 5’UTR, exons 1-2 and 3’UTR of PbCDPK4. It was inserted into the previously generated plasmid using XhoI. Primers CTAGAGGATCCCCGGGTACCAATTATATATATGTATATAGTGTACGTTG and CCATGATTACGAATTCTTGTATCATGTATATTCATGTTA were used to amplify a 0.5 kB fragment that was inserted into the previously derived plasmid digested with KpnI and EcoRI. The final insert was released from the targeting construct using NdeI and EcoRI. Transfections of TRAP/FlpL parasites (Panchal et al., 2012) were carried out using standard methodology. | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
Transgene: Mutant parasite expressing a transgene| top of page | |||||||||||||||||||
| Type and details of transgene | |||||||||||||||||||
| Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
| Transgene name | FlpL recombinase of yeast (FlpL) | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||
| Inducable system used | Flp/FRT | ||||||||||||||||||
| Additional remarks inducable system | The mutant expresses the yeast FlpL recombinase under the control of the promoter of trap. The mutant does not contain a selectable marker. This marker (the hdhfr gene) has been removed from the genome by using the Flp/FRT site-specific recombination (SSR) system. Removal of the hdhfr gene has been achieved by transmission of the mutant through mosquitoes, thereby activating expression of the FlpL recombinase that resulted in the excision of the hdhfr gene that was flanked by FRT sequences. | ||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||
| Additional remarks genetic modification | The FlpL coding sequence was flanked by 1.5 kb and 0.6 kb of 5′ and 3′ regulatory sequences of trap, respectively, and associated with a FRTed hdhfr selectable marker containing its own (eef1a) promoter and terminator sequences. | ||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Other details transgene | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Promoter | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_1349800 | ||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1335900 | ||||||||||||||||||
| Gene product | thrombospondin-related anonymous protein | sporozoite surface protein 2 | ||||||||||||||||||
| Gene product: Alternative name | TRAP; SSP2; SSP-2 | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||
| 3'-UTR | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_1349800 | ||||||||||||||||||
| Gene product | sporozoite surface protein 2 thrombospondin-related anonymous protein | ||||||||||||||||||
| Gene product: Alternative name | sporozoite surface protein 2; SSP2; SSP-2 | ||||||||||||||||||
| |||||||||||||||||||
| Insertion/Replacement locus | |||||||||||||||||||
| Replacement / Insertion | Replacement locus | ||||||||||||||||||
| Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
| Gene product | 6-cysteine protein | ||||||||||||||||||
| Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||