RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1510
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_0615200; Gene model (P.falciparum): PF3D7_0717500; Gene product: calcium-dependent protein kinase 4 (cdpk4)
Details mutation: The mutant contains a FRTed ORF of the cdpk4 locus
Details conditional mutagenesis: The ORF of cdpk4 is removed in the sporozoite stage by the Flp/FRT system
Transgene
 Transgene not Plasmodium: FlpL recombinase of yeast (FlpL)
Promoter: Gene model: PBANKA_1349800; Gene model (P.falciparum): PF3D7_1335900; Gene product: thrombospondin-related anonymous protein | sporozoite surface protein 2 (TRAP; SSP2; SSP-2)
3'UTR: Gene model: PBANKA_1349800; Gene product: sporozoite surface protein 2 thrombospondin-related anonymous protein (sporozoite surface protein 2; SSP2; SSP-2)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Sporozoite; Liver stage;
Last modified: 5 August 2016, 19:12
  *RMgm-1510
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 27425827
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherGovindasamy K; Brochet, M; Billker, O; Bhanot, P
Name Group/DepartmentDepartment of Microbiology and Molecular Genetics, University of Medicine and Dentistry of New Jerse
Name InstituteRutgers New Jersey Medical School, Rutgers, The State University of New Jersey
CityNewark, New Jersey
CountryUSA
top of page
Name of the mutant parasite
RMgm numberRMgm-1510
Principal nameCDPK4 cKO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNormal numbers of sporozoites in salivary glands. Reduced (2x) invasion of hepatocytes in vitro.
Liver stageReduced (2x) invasion of hepatocytes in vitro. No defect in development of liver stages and formation of merosomes.
Additional remarks phenotype

Mutant/mutation
The mutant is a 'Flp/FRT conditional knock-out mutant' of cdpk4. The mutant expresses the yeast FlpL recombinase under the control of the trap promoter  and contains a FRTed ORF (open reading frame) of the cdpk4 locus. 

This mutant has been generated by replacement of the endogenous cdpk4 gene by an cdpk4 gene with a FRTed ORF in the mutant RMgm-747 that expresses FlpL. This mutant expresses the yeast FlpL recombinase under the control of the promoter of trap and does not contain a selectable marker. The flpl gene is integrated into the silent 230p locus by double cross-over integration.

The cdpk4 ORF is removed from the genome by using the Flp/FRT site-specific recombination (SSR) system (see RMgm-269, RMgm-747). Removal of the FRTed ORF of cdpk4  has been achieved by  transmission of the mutant through mosquitoes, thereby activating expression of the FlpL recombinase in sporozoites that resulted in the excision of the ORF of cdpk4 which was flanked by FRT sequences.

Phenotype
In the CDPK4 cKO line, the CDPK4 open reading frame is excised during development in the mosquito midgut, generating a sporozoite population in which CDPK4 expression was below the level of detection. CDPK4 expression in liver stages of CDPK4 cKO line was similarly significantly reduced.

Normal numbers of sporozoites in salivary glands. Reduced (2x) invasion of hepatocytes in vitro. No defect in development of liver stages and formation of merosomes.

Additional information
Since P. berghei CDPK4 is essential for male gametogenesis, CDPK4 knockout parasites do not infect mosquitoes and consequently, cannot produce sporozoites. Therefore, a stage-specific knockout (cKO) mutant using the FlpL/FRT system was generated.

The mutant was used to determine the role of CDPK4 in sporozoites, invasion of liver cells and development of liver stages. Evidence is presented that CDPK4 is required for sporozoite invasion of hepatocytes.

Evidence is presented that inhibition of CDPK4 reduced sporozoite motility. The authors suggest 'that CDPK4 may be one of a number of effectors that mediate the Ca2+ fluxes observed in gliding sporozoites, and which are associated with micronemal secretion and motility'.

Other mutants
 See the link for other CDPK4 mutants

  Mutated: Mutant parasite with a mutated gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0615200
Gene Model P. falciparum ortholog PF3D7_0717500
Gene productcalcium-dependent protein kinase 4
Gene product: Alternative namecdpk4
top of page
Details of the genetic modification
Short description of the mutationThe mutant contains a FRTed ORF of the cdpk4 locus
Inducable system usedFlp/FRT
Short description of the conditional mutagenesisThe ORF of cdpk4 is removed in the sporozoite stage by the Flp/FRT system
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe CDPK4 cKO targeting vector was constructed by cloning (In-Fusion, Clontech) three PCR products into a vector that carries two FRT sites and the human dihydrofolate reductase expression cassette. Primers CTTGCATGCGCGGCCGCGTCTTTTACCATTTCTACAAT and TCGCCCTTATGCGGCCGCCTTTAACTTTCCTATATTTTATGC were used to amplify an approximately 1.0 kB fragment upstream of the 5’UTR of PbCDPK4 (PBANKA_0615200). The product was cloned into the vector linearized with NotI. Primers TAGGAACTTCCTCGAGTACATATGTTCATATTAAGAAA and CTGGGCTGCACTCGAGAATAAATGAGTATTTAAAATATATAGG were used to amplify a 2.6 kB fragment encompassing the 5’UTR, exons 1-2 and 3’UTR of PbCDPK4. It was inserted into the previously generated plasmid using XhoI. Primers CTAGAGGATCCCCGGGTACCAATTATATATATGTATATAGTGTACGTTG and CCATGATTACGAATTCTTGTATCATGTATATTCATGTTA were used to amplify a 0.5 kB fragment that was inserted into the previously derived plasmid digested with KpnI and EcoRI. The final insert was released from the targeting construct using NdeI and EcoRI. Transfections of TRAP/FlpL parasites (Panchal et al., 2012) were carried out using standard methodology.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameFlpL recombinase of yeast (FlpL)
top of page
Details of the genetic modification
Inducable system usedFlp/FRT
Additional remarks inducable system The mutant expresses the yeast FlpL recombinase under the control of the promoter of trap. The mutant does not contain a selectable marker. This marker (the hdhfr gene) has been removed from the genome by using the Flp/FRT site-specific recombination (SSR) system. Removal of the hdhfr gene has been achieved by transmission of the mutant through mosquitoes, thereby activating expression of the FlpL recombinase that resulted in the excision of the hdhfr gene that was flanked by FRT sequences.
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe FlpL coding sequence was flanked by 1.5 kb and 0.6 kb of 5′ and 3′ regulatory sequences of trap, respectively, and associated with a FRTed hdhfr selectable marker containing its own (eef1a) promoter and terminator sequences.
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_1349800
Gene Model P. falciparum ortholog PF3D7_1335900
Gene productthrombospondin-related anonymous protein | sporozoite surface protein 2
Gene product: Alternative nameTRAP; SSP2; SSP-2
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_1349800
Gene productsporozoite surface protein 2 thrombospondin-related anonymous protein
Gene product: Alternative namesporozoite surface protein 2; SSP2; SSP-2
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATGGTACCATGA-CATCATTTATAAATCATG
Additional information primer 1P1 (KpnI); 230p targeting region
Sequence Primer 2ATACTGCAGTGTGTTTTATTTGGATGTGC
Additional information primer 2P2 (PstI); 230p targeting region
Sequence Primer 3TTGGGCCCTTCTCTTGAGCCCGTTAAT
Additional information primer 3P3 (ApaI); 230p targeting region
Sequence Primer 4TTGGGCCCTAGGAAATTTGTTTATTTTTATA
Additional information primer 4P4 (ApaI); 230p targeting region
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren