top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_1349800
|
Gene Model P. falciparum ortholog |
PF3D7_1335900
|
Gene product | thrombospondin-related anonymous protein | sporozoite surface protein 2 |
Gene product: Alternative name | sporozoite surface protein 2; SSP2; SSP-2; TRAP |
top of page |
Details of the genetic modification |
Short description of the mutation | The cytoplasmic tail domain (CTD) of P. berghei TRAP replaced with the CTD of TRAP of P. falciparum |
Inducable system used | No |
Short description of the conditional mutagenesis | Not available |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | pbdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The construct used results in replacement of the wild type trap-gene with a mutated trap gene. In the mutated trap gene the cytoplasmic tail domain (CTD) of P. berghei TRAP is replaced with the CTD of the TRAP protein of P. falciparum (thrombospondin-related anonymous protein; PF13_0201). The CTD of P. falciparum TRAP was obtained using the following primers: PfTRAPfor (5' CGGGATCCGCAGCAACACCCTATGCCGGAGAACC 3' and PfTRAPrev (5' TGCTCTAGATTAATTCCACTCGTTTTCTTCAGG 3'. The mutated TRAP gene is under the control of the 5'-UTR of TRAP and the 3'-UTR of pbdhfr. |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
|
top of page |