Summary

RMgm-146
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0800500; Gene model (P.falciparum): PF3D7_1252200; Gene product: chitinase (CHT1)
Phenotype Fertilization and ookinete; Oocyst;
Last modified: 18 February 2009, 14:42
  *RMgm-146
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 11349074
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherJ.T. Dessens; R.E. Sinden
Name Group/DepartmentDepartment of Biolology
Name InstituteImperial college of Science Technology and Medicine
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-146
Principal namepbcht1-ko (clone 33 and 37)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal numbers of gametocytes, gametes, zygotes and mature ookinetes are formed. In Giemsa stained smears the morphology of mutant ookinetes is comparable to that of wild type ookinetes. Ookinetes have a reduced (30-90%) capacity to produce oocysts in A. stephensi mosquitoes(see phenotype 'Oocysts').
OocystWhen fed to A. stephensi mosquitoes, significant reductions in oocyst numbers of between 30 and 90% were obtained with the mutant parasites. The oocyst formed, produced normal numbers of sporozoites, that were infectious to the mammalian host.
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Chitinase (CHT1; Genbank accession number: AJ305256).

Protein (function)
CHT1, a secreted protein, is expressed in the ookinete stage and located in the micronemes. It contains putative proenzyme and chitin-binding domains. Chitinases are enzymes that hydrolize chitin, a (1-4)-β homopolymer of N-acetylglucosamine.

Phenotype
The phenotype analyses indicate a role during the transition of the ookinete into the oocyst stage (see also 'Additional information'). However, CHT1 is not essential for mosquito infectivity.

Additional information
Chitinase activity is thought to be critical for ookinetes to penetrate the chitin-containing peritophic matrix and midgut epithelial cells.
Feeding of in vitro cultured mature mutant ookinetes to A. stephensi resulted in the same reduction in oocyst formation as was found after feeding mutant gametocytes. In the ookinete feeds, the ookinetes invade the midgut cells before a perithrophic membrane is formed, suggesting that P. berghei chitinase is not involved in penetration of the perithrophic membrane.
The  chitinase inhibitor allosamidin effectively abolished oocyst development of P. falciparum and P. gallinaceum. This inhibitor did not affect P. berghei infectivity in A. stephensi as measured by oocyst production, suggesting that allosamidin does not affect P. berghei CHT1.
CHT1 of P. falciparum is significantly different from P. berghei CHT1, in that the P. falciparum protein does not appear to be a pro-enzyme, nor does it appear to have a chitin-binding domain.
In P. falciparum a mutant has been generated with a disrupted gene encoding pfCHT1 (Y. Tsai et al., 2001, Infect. Immun. 69, 4048-54). This mutant  had normal gametocytogenesis, exflagellation, and ookinete formation but was markedly impaired in its ability to form oocysts in Anopheles freeborni midguts.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0800500
Gene Model P. falciparum ortholog PF3D7_1252200
Gene productchitinase
Gene product: Alternative nameCHT1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/BamHI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption The DHFR/TS cassette was inserted between nucleotide positions 660 and 1960 of PbCHT1, thereby removing 1.3 kb of the PbCHT1 central coding sequence, including the sequences encoding the putative binding pocket and the catalytic site.
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGATCCATTTTTTTGGAGACTTTATAACA
Additional information primer 1CHIT-BAM (BamHI); 5'
Sequence Primer 2GAATTCTAAAATTTCCCTTGGAGA
Additional information primer 2CHIT-ERI (EcoRI); 5'
Sequence Primer 3GGTACCAAATATATGCAATGTAACTAAAA
Additional information primer 3CHIT-KPN (KpnI); 3'
Sequence Primer 4AAGCTTAAACAATGGCATGGAGG
Additional information primer 4CHIT-HIND (HindIII); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6