RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-1440
Malaria parasiteP. berghei
Genotype
Transgene
Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_1003900; Gene model (P.falciparum): PF3D7_0406200; Gene product: sexual stage-specific protein precursor (Pfs16)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Phenotype Gametocyte/Gamete; Liver stage;
Last modified: 15 January 2020, 15:28
  *RMgm-1440
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 31551073
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherCaldelari R; Braks JA; Janse C.J.
Name Group/DepartmentLeiden Malaria Research Group, Parasitology
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-1440
Principal name300
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationNo
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteVery weak (background?) fluorescence in gametocytes.
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageGFP expression in liver stages (see for more details below)
Additional remarks phenotype

Mutant/mutation
In the mutant GFP is expressed under control of the PBANKA_1003900 promoter. The GFP-expression cassette has been introduced as episomes/circular plasmid
This gene is a 'syntenic ortholog' of sexual stage-specific protein precursor (Pfs16; PF3D7_0406200) of P. falciparum.

The phenotype has not been analysed in detail. Very weak (background?) fluorescence was observed in gametocytes.

The similarity of P. falciparum Pfs16 and the syntenic P. berghei gene (Pbs16?) is below threshold.

See also RMgm-1439 for a mutant with a disrupted PBANKA_1003900) gene locus
See the link PBANKA_1003900 for other mutants

Additional information from the paper

PBANKA_1003900 was found to be highly transcribed in liver stages.
PBANKA_1003900 is a syntenic ortholog of P. falciparum sexual stage-specific protein precursor (Pfs16; PF3D7_0406200) which is expressed early during development of P. falciparum gametocytes. Plasmodium berghei parasites expressing an mCherry-tagged PBANKA_1003900 provided experimental evidence that this gene is also expressed in gametocytes and was, therefore, annotated as a gametocyte specific protein. However, substantial PBANKA_1003900 transcript levels were only detected in liver stages.
Mutants lacking expression of PBANKA_1003900 show no phenotype throughout the complete life cycle, including liver stages.
GFP was not detectable in any of the blood stages, including gametocytes. In contrast, GFP expression was detected by fluorescence microscopy of infected HeLa cells fixed at different time points (24 h, 48 h, 54 h, 60 h). At 24 h of liver/EEF stage development no or only very weak GFP-fluorescence was detectable. At 48 h of EEF stage development, the signal was readily visible and at 54 h and 60 h post infection the fluorescent signal was profoundly intense. When performing live cell imaging, the first signals were observed at 30 h post infection. From 45 h onwards the protein was substantially expressed confirming the results obtained from fixed cells. These fluorescence patterns (fixed and live) nicely confirmed the RNA-seq data during EEF stage development. Interestingly, analyses of gene-deletion mutants lacking PBANKA_1003900 demonstrated that the gene is not essential at any developmental stage throughout the complete parasite life cycle. According to the expression profile deduced from the RNA-seq analysis and also confirmed by the promoter analyses, it is appropriate to revise the annotation as “gametocyte specific protein” and to rename it as “liver specific protein 3 (LISP3)”.


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructCircular plasmid
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo generate transgenic parasites expressing gfp under control of the promoter of PBANKA_1003900 (PBANKA_1003900GFP), an episomal PbGFPcon vector was used. First, the PBANKA_1003900 promoter (1.7 kb) was amplified using primers GCTCTACCAATTTTGTGTCAC and GGATCCTTAAAAATTAATTTTGTATAAAATCG and cloned into a pCR2.1-TOPO vector (Invitrogen) and sequenced. Then the P. berghei elongation factor-1α promoter of PbGFPcon was exchanged for the PBANKA_1003900 promoter (EcoRV from pCR2.1-TOPO vector/BamHI) and the gfp gene was re-introduced in the correct orientation as a BamHI fragment. Finally the construct was used to transfect the reference wild type P. berghei ANKA parasite line (cl15cy1 (ANKAwt)) to generate line 300 (PBANKA_1003900GFP). Transfection with the episomal construct and positive selection of transfected parasites with pyrimethamine was performed as described previously.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1003900
Gene Model P. falciparum ortholog PF3D7_0406200
Gene productsexual stage-specific protein precursor
Gene product: Alternative namePfs16
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionNot available
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4