RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-144
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1116000; Gene model (P.falciparum): PF3D7_0616500; Gene product: TRAP-like protein (TLP)
Phenotype Sporozoite; Liver stage;
Last modified: 24 July 2011, 12:17
  *RMgm-144
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18441124
Reference 2 (PMID number) : 20159960
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherK. Heiss, K. Matuschewski
Name Group/DepartmentDepartment of Parasitology
Name InstituteHeidelberg University School of Medicine
CityHeidelberg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-144
Principal nametlp(-)-1; tlp(-)-2
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of midgut (oocyst-derived) and salivary gland sporozoites are produced. Sporozoites showed normal gliding motility, albeit at a lower frequency. Sporozoites showed full in vitro and in vivo infectivity in cultured hepatoma cells and when injected intravenously into rats, respectively.
Liver stageSporozoites showed full in vitro and in vivo infectivity in cultured hepatoma cells and when injected intravenously into rats, respectively.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of TLP (Trap-Like Protein; TRAP2).

Protein (function)
TLP belongs to the TRAP/MIC2 family of transmembrane proteins, members of which link extracellular adhesion to the intracellular actomyosin motor complex that plays a role in (gliding) motility and cell invasion.
Similar to the Plasmodium sporozoite protein, TRAP, and the ookinete protein, CTRP, TLP possesses an extracellular domain architecture that is comprised of von Willebrand factor A (vWA) and thrombospondin type 1 (TSP1) domains, plus a short cytoplasmic domain.

Phenotype
The phenotype analyses indicate that TLP has no essential role during the life cycle and is not involved in gliding motility of sporozoites and invasion of hepatocytes.   
An independent mutant RMgm-143 has been generated which lacks expression of TLP. Phenotype analyses of this mutant indicate a role of TLP in cell traversal of the sporozoite stage. However, the lack of a 'clear' phenotype indicates redundancy of the function of TLP. See also the paper of Lacroix and Menard ( 2008, Trends Parasitol, 24, 431-34) for a comparison of the phenotype of both mutants.

Additional information
Transcription of tlp have been detected by RT-PCR in blood stages and sporozoites.

A mutant has been generated (RMgm-149) that expresses a mutated form of TRAP (thrombospondin-related anonymous protein; PB000374.03.0; PF13_0201), in which the cytoplasmic tail domain (CTD) of TRAP is replaced with the CTD domain of TLP. The CTD of TLP can complement the function of the CTD of TRAP, albeit not as well as TRAP as shown by the (strongly) reduced invasion of salivary glands and hepatocytes.

Adhesion and motility of sporozoites of this mutant has been analysed in another study (Hegge et al., 2010, FASEB J; PMID: 20159960). Analyses of gliding and adhesion properties on glass slide indicate that 'TLP appears to increase the probability of continued adhesion formation during gliding, either by stabilization of newly formed adhesion sites or by increasing the speed of adhesion formation'. It is suggested that in migrating through tissue, the loss of TLP function could therefore result in reduced attachment and thus slower progression through tissues.

Other mutants
RMgm-143: An independant mutant lacking expression of TLP.
RMgm-149:  A mutant that expresses a mutated form of TRAP (thrombospondin-related anonymous protein; PB000374.03.0; PF13_0201), in which the cytoplasmic tail domain (CTD) of TRAP is replaced with the CTD domain of TLP.


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1116000
Gene Model P. falciparum ortholog PF3D7_0616500
Gene productTRAP-like protein
Gene product: Alternative nameTLP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 15' GGGGTACCACAAATTAAAGAACAAATCGAGGG 3'
Additional information primer 1TLPrepI_for
Sequence Primer 25' CCCAAGCTTGAATGGCTCTTAATTTGCCAGTCC 3'
Additional information primer 2TLPrepI_rev
Sequence Primer 35' CGGAATTCGAGCCGCCTCTATTTAATATTGC 3'
Additional information primer 3TLPrepII_for
Sequence Primer 45' TCCCCGCGGTGAACCTCCCAATAGACCCATTCC 3'
Additional information primer 4TLPrepII_rev
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6