Summary

RMgm-142
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1037800; Gene model (P.falciparum): PF3D7_1404300; Gene product: secreted ookinete adhesive protein, putative (SOAP)
Phenotype Fertilization and ookinete; Oocyst; Sporozoite; Liver stage;
Last modified: 19 February 2009, 21:24
  *RMgm-142
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 12828632
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherDessens, J.T., Sinden, R.E.
Name Group/DepartmentDepartment of Biological Sciences
Name InstituteImperial College London
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-142
Principal nameSOAP KO (39); SOAP KO (47)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteMutants developed gametocytes and formed ookinetes in vitro in similar numbers to, and morphologically indistinguishable from, wild type parasites in Giemsa-stained preparations. Reduced numbers of oocysts (reduction of 60-85%) are produced in A. stephensi mosquitoes.
OocystNormal numbers of ookinetes are produced. Reduced numbers of oocysts (reduction of 60-85%) are produced in A. stephensi mosquitoes. Although oocyst numbers were markedly reduced in mutant-infected mosquitoes, those oocysts that developed were morphologically indistinguishable from wild type oocysts of comparable age, and formed large numbers of sporozoites similar to wild type oocysts.
SporozoiteMutant sporozoites appeared morphologically normal and successfully invaded the salivary glands. Mosquitoes that were infected with mutant sporozoites successfully transmitted the parasite to mice.
Liver stageMutant sporozoites appeared morphologically normal and successfully invaded the salivary glands. Mosquitoes that were infected with mutant sporozoites successfully transmitted the parasite to mice.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of SOAP (secreted ookinete adhesive protein)

Protein (function)
SOAP, a 21-kDa protein, has the hallmarks of an extracellular soluble (secreted) protein: it contains a predicted cleavable amino-terminal signal peptide, but lacks other typical organellar targeting or membrane anchoring signals. The conserved protein contains 12, closely spaced, cysteine residues and comparison of SOAP of different Plasmodium species indicates a modular structure of two cysteine-rich domains separated by a spacer sequence of variable amino acid length and composition.
SOAP is located in the micronemes of ookinetes.

Phenotype
The phenotype analyses indicate a role in the transformation of the ookinete into the oocyst. Ookinetes appear to have a reduced capacity to invade midgut epithelial cells (see also additional information).

No evidence was found of invaded SOAP-KO ookinetes suffering increased losses after entry of the midgut epithelium, indicating that the impairment of midgut invasion is caused by a reduced ability to enter the epithelial cells. However, it should be noted that P. berghei ookinete-invaded A. stephensi midgut cells have been shown to undergo cell death and subsequent removal through a purse-string mechanism. Thus, it cannot be ruled out that invaded ookinetes killed by the mosquito might be removed by this process.

Additional information
Feeding mutant gametocytes or in vitro formed mature ookinetes resulted in a comparable reduction in formation of oocysts. These results indicate that neither the number of ookinetes developing in the midgut, nor the effects of the peritrophic membrane or digestive midgut enzymes are likely to be factors contributing to the reductions in mutant oocyst development observed. 

Ookinetes lacking expression of SOAP that are directly injected into the hemocoel, thereby by-passing the midgut wall, develop into oocysts and these ookinetes can transform in vitro into oocysts, indicating that SOAP is not essential for transformation of ookinetes into oocysts (Nacer, A. et al., Malar J.  19;7:82).

Evidence has been presented that SOAP binds to laminin γ1 in yeast cells. The interaction of PbSOAP with mosquito laminin γ1 in the yeast-two-hybrid assays suggests that the native protein may interact with the mosquito basal lamina and, hence, may play a role in ookinete-to-oocyst transition in addition to its demonstrated role in midgut invasion. This is not unprecedented: previously, the ookinete proteins P25, P28 and CTRP were shown to interact with basal lamina components as well as having functions in midgut invasion. P25 and P28 were shown to interact with laminin, while the ookinete micronemal protein CTRP has been shown to interact with both laminin and collagen IV 
 
Other mutants
 


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1037800
Gene Model P. falciparum ortholog PF3D7_1404300
Gene productsecreted ookinete adhesive protein, putative
Gene product: Alternative nameSOAP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption Disruption was achieved by inserting a modified Toxoplasma gondii dihydrofolate reductase–thymidylate synthase gene (TgDHFR/TS) into the SOAP locus at nucleotide position 400 by double cross-over homologous recombination.
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationDisruption was achieved by inserting a modified Toxoplasma gondii dihydrofolate reductase–thymidylate synthase gene (TgDHFR/TS) into the SOAP locus at nucleotide position 400 by double cross-over homologous recombination.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGATCCTCTTCTGAAAAAACAACGTAAT
Additional information primer 1SOAP-Bam
Sequence Primer 2GAATTCTGGTAGGCATTTTACACAC
Additional information primer 2SOAP-ERI
Sequence Primer 3GGTACCGATATATGTATTATATGGTATATG
Additional information primer 3SOAP-Kpn
Sequence Primer 4AAGCTTGTGAATGTGAATGCAGTTGT
Additional information primer 4SOAP-Hind
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6