| top of page |
| Details of the target gene |
| Gene Model of Rodent Parasite |
PBANKA_1210300
|
| Gene Model P. falciparum ortholog |
PF3D7_1011900
|
| Gene product | heme oxygenase |
| Gene product: Alternative name | HO; heam oxygenase |
| top of page |
| Details of the genetic modification |
| Name of the tag | GFP |
| Details of tagging | C-terminal |
| Additional remarks: tagging | |
| Commercial source of tag-antibodies | |
| Type of plasmid/construct | (Linear) plasmid single cross-over |
| PlasmoGEM (Sanger) construct/vector used | No |
| Modified PlasmoGEM construct/vector used | No
|
| Plasmid/construct map |
|
| Plasmid/construct sequence |
|
| Restriction sites to linearize plasmid |
|
| Selectable marker used to select the mutant parasite | hdhfr |
| Promoter of the selectable marker | eef1a |
| Selection (positive) procedure | pyrimethamine |
| Selection (negative) procedure | No |
| Additional remarks genetic modification | The unsuccessful attempt(s) to tag this gene with GFP indicates an essential role for asexual blood stage growth/multiplication. Attempt(s) to disrupt the gene were also unsuccessful (see RMgm-1415)
Most mammalian cells use a different strategy to nullify haem toxicity by converting it to biliverdin (BV), a step catalysed by haem oxygenase (HO). The malaria parasite converts haem into the chemically inert haemozoin to avoid toxicity.
To tag the endogenous locus with GFP, we generated a pbHO-GFP construct by single crossover homologous recombination. An 876-bp region coding for the C-terminus of PbHO without the stop codon was inserted in-frame and upstream of the GFP sequence in plasmid p277 containing the human DHFR cassette and conveying resistance to pyrimethamine, as previously described49. The primers used to amplify this fragment are provided below: CCCCGGTACCGTAGAGATTATATTTACCATCTTGAAG, T1031; CCCCGGGCCCTTTTTTTATATTTTCAAAATGTTTTGTCAAAATCATC, T1032. Prior to transfection, the final construct was digested with Bsm1, which cuts the plasmid in the middle of the insert. |
| Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences 
Primer information: Primers used for amplification of the target sequences 
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
| Sequence Primer 3 | |
| Additional information primer 3 | |
| Sequence Primer 4 | |
| Additional information primer 4 | |
| Sequence Primer 5 | |
| Additional information primer 5 | |
| Sequence Primer 6 | |
| Additional information primer 6 | |
|
|
| top of page |
*RMgm-1416