RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1363
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1028300; Gene model (P.falciparum): PF3D7_1414400; Gene product: serine/threonine protein phosphatase PP1 (PP1)
PhenotypeNo phenotype has been described
Last modified: 10 January 2016, 12:24
  *RMgm-1363
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 2
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26735921
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherZhang M; Nussenzweig V
Name Group/DepartmentDepartment of Pathology
Name InstituteNew York University School of Medicine
CityNew York
CountryUS
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1028300
Gene Model P. falciparum ortholog PF3D7_1414400
Gene productserine/threonine protein phosphatase PP1
Gene product: Alternative namePP1
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe unsuccessful attempts to disrupt this gene indicate an essential function during asexual blood stage growth/multiplication
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1gaagaatatcacattttgttttata
Additional information primer 1gccataataaaagttactatatttt
Sequence Primer 2cgacataaaaatacagtgatttta
Additional information primer 2atttgatttaatttttaaggtgcgc
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren