top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_1028300
|
Gene Model P. falciparum ortholog |
PF3D7_1414400
|
Gene product | serine/threonine protein phosphatase PP1 |
Gene product: Alternative name | PP1 |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct used | (Linear) plasmid double cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Partial or complete disruption of the gene | Complete |
Additional remarks partial/complete disruption |
|
Selectable marker used to select the mutant parasite | hdhfr |
Promoter of the selectable marker | eef1a |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The unsuccessful attempts to disrupt this gene indicate an essential function during asexual blood stage growth/multiplication |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | gaagaatatcacattttgttttata |
Additional information primer 1 | gccataataaaagttactatatttt |
Sequence Primer 2 | cgacataaaaatacagtgatttta |
Additional information primer 2 | atttgatttaatttttaaggtgcgc |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
top of page |