RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-1362

Malaria parasite	P. berghei
Genotype
Tagged	Gene model (rodent): PBANKA_0718100; Gene model (P.falciparum): PF3D7_0416100; Gene product: glutamyl-tRNA(Gln) amidotransferase subunit A (GaTA) Name tag: 4xMyc
Phenotype	Asexual bloodstage;

Last modified: 5 April 2016, 10:26

*RMgm-1362

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene tagging
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 26318454
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/Researcher	Mailu BM; Gradner MJ
Name Group/Department	Center for Infectious Disease Research
Name Institute	Center for Infectious Disease Research
City	Seattle
Country	US
top of page
Name of the mutant parasite
RMgm number	RMgm-1362
Principal name	PbGatA-Myc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Fluorescent structures in blood stages exhibiting a typical apicoplast appearance
Gametocyte/Gamete	Not tested
Fertilization and ookinete	Not tested
Oocyst	Not tested
Sporozoite	Not tested
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation The mutant expresses a 4xMyc-tagged version of GaTA Protein (function) The malaria parasite Plasmodium falciparum apicoplast indirect aminoacylation pathway utilizes a non-discriminating glutamyl-tRNA synthetase to synthesize Glu-tRNAGln and a glutaminyl-tRNA amidotransferase to convert Glu-tRNAGln to Gln-tRNAGln. Plasmodium falciparum and other apicomplexans possess a unique heterodimeric glutamyl-tRNA amidotransferase consisting of GatA and GatB subunits (GatAB). The P. falciparum GatA and GatB subunits were localized to the apicoplast in blood stage parasites Phenotype Unsuccessful attempts to delete the gata gene (RMgm-1361) indicates an essential role during blood stage growth/multiplication. To confirm apicoplast localization that was determined via transfection of the episomal constructs in P. falciparum, the endogenous gene encoding the P. berghei ortholog of PfGatA (PBANKA_071810) was tagged with a quadruple Myc tag. Fixed blood stage parasites were stained with anti-Myc antibody to detect PbGatA and ACP antisera to detect the apicoplast, and the samples were observed using Deltavision deconvolution fluorescence microscopy. Structures containing the Myc-tagged PbGatA (PbGatA-myc) exhibited a typical apicoplast appearance similar to that observed using the episosomal PfGatA-GFP and PfGatB-GFP constructs in P. falciparum in vitro. Additional information Other mutants Unsuccessful attempts to delete the gata gene (RMgm-1361)

Tagged: Mutant parasite with a tagged gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_0718100

Gene Model P. falciparum ortholog

PF3D7_0416100

Gene product

glutamyl-tRNA(Gln) amidotransferase subunit A

Gene product: Alternative name

GaTA

top of page

Details of the genetic modification

Name of the tag

4xMyc

Details of tagging

C-terminal

Additional remarks: tagging

Commercial source of tag-antibodies

Type of plasmid/construct

(Linear) plasmid single cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Selectable marker used to select the mutant parasite

tgdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

A 4x myc tag was appended to the 3′ end of the gene encoding the putative apicoplast-targeted P. berghei GatA (PlasmoDB ID PBANKA_071810) as described previously (18). A 3.5-kb fragment of the 3′ end of the gene without the stop codon was amplified from P. berghei ANKA genomic DNA using primers PbGatA_F2 (TACCGCGGATAATATACAACCAATAACATTATAG) and PbGatA_R (ATACTAGTACTAGCCTTATTTTCCAAATTGTGAAC); the SacII and SpeI restriction sites are underlined. Polymerase chain reactions (PCR) (50 μl) contained 50 ng of genomic DNA, 0.1 μm of each primer, 5 μl of buffer, and 1 μl of Advantage 2 polymerase (Clontech). The PCR product was digested with SacII and SpeI and cloned into the b3D myc vector (18). P. berghei ANKA parasites were transfected, and parasites with myc insertions in the gatA gene were selected and cloned as described (18).

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page