RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1344
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1349800; Gene model (P.falciparum): PF3D7_1335900; Gene product: thrombospondin-related anonymous protein | sporozoite surface protein 2 (TRAP; SSP2)
Details mutation: canonical rhomboid motif AGGIIGG changed to VALIIGV
Transgene
 Transgene not Plasmodium: mCherry
Promoter: Gene model: PBANKA_0501200; Gene model (P.falciparum): PF3D7_1016900; Gene product: early transcribed membrane protein 10.3 | protein of early gametocyte 4 (UIS4, up-regulated in infective sporozoites; ETRAMP10.3)
3'UTR: Gene model: PBANKA_0501200; Gene product: early transcribed membrane protein up-regulated in infective sporozoites (UIS4, up-regulated in infective sporozoites; ETRAMP10.3)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Sporozoite; Liver stage;
Last modified: 25 October 2015, 14:07
  *RMgm-1344
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26271010
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone RMgm-1339
Other information parent lineA P.berghei ANKA transgenic reporter line expressing mCherry under control of the (sporozoite and liver-specific) UIS4 promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
top of page
The mutant parasite was generated by
Name PI/ResearcherHopp CS; Sinnis P
Name Group/DepartmentDepartment of Molecular Microbiology and Immunology
Name InstituteJohns Hopkins Bloomberg School of Public Health
CityBaltimore
CountryUSA
top of page
Name of the mutant parasite
RMgm numberRMgm-1344
Principal nameTRAP-VAL
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of oocysts and midgut-derived sporozoites are produced. Strongly reduced (5x) numbers of salivary gland sporozoites. Motility of sporozoites is impaired. Sporozoites show a reduced capacity to invade hepatocytes in vitro.
Liver stageStrongly reduced (5x) numbers of salivary gland sporozoites. Motility of sporozoites is impaired. Sporozoites show a reduced capacity to invade hepatocytes in vitro. Sporozoites show reduced (10-100x) infectivity to mice.
Additional remarks phenotype

Mutant/mutation
In the mutant the endogenous trap gene is replaced by a mutated trap gene in which canonical rhomboid motif AGGIIGG is changed to VALIIGV. This mutant is a similar mutant as mutant RMgm-777. The difference with RMgm-777 is the reporter protein expressed (mCherry instead of GFP under control of different promoters)

  Mutated: Mutant parasite with a mutated gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1349800
Gene Model P. falciparum ortholog PF3D7_1335900
Gene productthrombospondin-related anonymous protein | sporozoite surface protein 2
Gene product: Alternative nameTRAP; SSP2
top of page
Details of the genetic modification
Short description of the mutationcanonical rhomboid motif AGGIIGG changed to VALIIGV
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid EcoRV, XhoI
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTransfection plasmids designed to replace the endogenous locus with mutant or wild type TRAP were generated using pDEF-hDHFR containing the human dihydrofolate reductase (hDHFR) selection cassette. A 576 bp fragment of 5’UTR located 1000 bp upstream of TRAP was amplified by PCR using template genomic DNA from P.berghei ANKA parasites, with the primer pair, PbTRAP5’UTR-FWD (5’CAGCTAAGCTTGATATCCAAAAGTACAACATAAAAGGAACTGAATG-3’) and PbTRAP5’UTR-REV (5’- CAGCTAAGCTTCTCTTTTTTACATGTATTCAATTAGCATGC -3’) and this was cloned into pDEF-hDHFR upstream of the selection cassette. A second fragment, consisting of 1062 bp of 5’UTR directly upstream of the TRAP gene, 1821 bp of TRAP open reading frame, and 2057 bp of TRAP 3’UTR was amplified by PCR using the primer pairs PbTRAPFWD (5’CTGGTACCGAGAAATTCCTTCGTTTTATAATTTATAAAGC- 3’) and PbTRAPREV (5’CCGGTACCCTCGAGCAGAGCCAGGATATGAACTATTTTAAAAC-3’). This was cloned into pDEF-hDHFR downstream of the selection cassette to generate the plasmid pTRAP, which was then used to generate the TRAP mutants using the Quick Change Mutagenesis kit (Stratagene).

Generation of the TRAP-VAL cleavage site mutant required 2 steps. Primers MUT-TRAPVAL1FWD and MUT-TRAP VAL1REV were used to generate pTRAP-VALIIGG and then this plasmid was mutated to VALIIGV using primers, MUT-TRAP-VALGV-2FWD and MUT-TRAP-VALGV-2REV. The construct was sequenced to confirm the presence of the desired mutation and digested with EcoRV and XhoI to liberate the fragment used for transfection
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CTAATAACGGATATAAAATTGTTGCTCTTATTATTGGAGGATTAGC
Additional information primer 1MUT-TRAP-VAL 1 FWD
Sequence Primer 2GCTAATCCTCCAATAATAAGAGCAACAATTTTATATCCGTTATTAG
Additional information primer 2MUT-TRAP VAL1 REV
Sequence Primer 3ATTGTTGCTCTTATTATTGGAGTTTTGCTATAATTGGATGCATAGGTGTTG
Additional information primer 3MUT-TRAP VALGV-2FWD
Sequence Primer 4CAACACCTATGCATCCAATTATAGCTAAAACTCCAATAATAAGAGCAACAAT
Additional information primer 4MUT-TRAP-VALGV-2REV
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene namemCherry
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) PCR construct double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedureNo
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_0501200
Gene Model P. falciparum ortholog PF3D7_1016900
Gene productearly transcribed membrane protein 10.3 | protein of early gametocyte 4
Gene product: Alternative nameUIS4, up-regulated in infective sporozoites; ETRAMP10.3
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_0501200
Gene productearly transcribed membrane protein up-regulated in infective sporozoites
Gene product: Alternative nameUIS4, up-regulated in infective sporozoites; ETRAMP10.3
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren