Back to search resultsSummaryRMgm-133
|
||||||||
*RMgm-133| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene tagging |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 16888139 Reference 2 (PMID number) : 20169188 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | G.R. Mair, C.J. Janse, A.P. Waters |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center (LUMC) |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-133 |
| Principal name | 683cl4 (683cl1; 683cl2) |
| Alternative name | PbDOZI::GFP |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Normal production of gametocytes and gametes. A punctate GFP-fluorescence pattern that appeared to be restricted to the cytoplasm of female gametocytes was observed in live and fixed cells after immunofluorescence assay (IFA) analysis with antibodies to GFP. The mutant showed wild-type fertilization rates and zygote/ookinete production. |
| Fertilization and ookinete | The mutant showed wild-type fertilization rates and zygote/ookinete production. |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation Additional information: |
Tagged: Mutant parasite with a tagged gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1217700 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0320800 | ||||||||||||||||||||||||||
| Gene product | ATP-dependent RNA helicase DDX6 | ||||||||||||||||||||||||||
| Gene product: Alternative name | DOZI, Protein development of zygote inhibited | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Name of the tag | EGFP | ||||||||||||||||||||||||||
| Details of tagging | C-terminal | ||||||||||||||||||||||||||
| Additional remarks: tagging | |||||||||||||||||||||||||||
| Commercial source of tag-antibodies | Roche | ||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() ATCTTTATTTATTATATATATTTTTATTTATTCTATTTTGTTCCTTTTTTTTTATTTGTA
| ||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | C-terminal GFP-tagging of DOZI was performed using a construct that integrates through single cross-over homologous recombination into the pbdozi-locus and contains the tgdhfr/ts selectable marker. The disadvantage of using an insertion construct is that the construct can be removed from the genome, thereby restoring the wild type genotype. The primers as shown below were used to amplify the 2153 bps targeting region of pbdozi. | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||