RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-1301
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1233200; Gene model (P.falciparum): PF3D7_0518400; Gene product: cyclin, putative (CYC3)
Phenotype Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 18 June 2015, 19:08
  *RMgm-1301
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26018192
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherKaneko I; Yuda M
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University Graduate School of Medicine
CityTsu, Mie
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-1301
Principal nameCYC3(–)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteThe mutants developed into ookinetes with normal conversion rates and morphology.
OocystStrongly reduced oocyst production.
SporozoiteStrongly reduced (salivary gland) sporozoite production.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of CYC3 (cyclin)

Protein (function)

Phenotype
The successful knock-out of cyc3 indicates it has no essential role during blood stage development/multiplication. The mutants developed into ookinetes with normal conversion rates and morphology. Strongly reduced oocyst and sporozoite production.

Additional information
No differences in DNA contents were observed between wild-type ookinetes and disruptants.
Oocysts observed with phasecontrast microscopy were smaller than corresponding wild-type oocysts. The oocyst number of the disruptants was approximately 75% of that of wild-type parasites at 2 dpi and decreased to 20%–30% of that of the wild-type parasites at 14 dpi. The average diameter of the oocysts at this time point was approximately 65% of that of wild-type oocysts.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1233200
Gene Model P. falciparum ortholog PF3D7_0518400
Gene productcyclin, putative
Gene product: Alternative nameCYC3
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GTATAACCTACACAAGAGTAGCTAAGC
Additional information primer 1CTCATCTACAAGCATCgtcgacAATCTTTATGTGTCCTTGGAGG
Sequence Primer 2CCTTCAATTTCGgatccactagGATAAAAATACTACAGCATCTAC
Additional information primer 2CATCCATATATTACTCCTAAAACTATATGC
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6