RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1301

Malaria parasite	P. berghei
Genotype
Disrupted	Gene model (rodent): PBANKA_1233200; Gene model (P.falciparum): PF3D7_0518400; Gene product: cyclin, putative (CYC3)
Phenotype	Fertilization and ookinete; Oocyst; Sporozoite;

Last modified: 18 June 2015, 19:08

*RMgm-1301

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene disruption
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 26018192
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/Researcher	Kaneko I; Yuda M
Name Group/Department	Department of Medical Zoology
Name Institute	Mie University Graduate School of Medicine
City	Tsu, Mie
Country	Japan
top of page
Name of the mutant parasite
RMgm number	RMgm-1301
Principal name	CYC3(–)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	The mutants developed into ookinetes with normal conversion rates and morphology.
Oocyst	Strongly reduced oocyst production.
Sporozoite	Strongly reduced (salivary gland) sporozoite production.
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation The mutant lacks expression of CYC3 (cyclin) Protein (function) Phenotype The successful knock-out of cyc3 indicates it has no essential role during blood stage development/multiplication. The mutants developed into ookinetes with normal conversion rates and morphology. Strongly reduced oocyst and sporozoite production. Additional information No differences in DNA contents were observed between wild-type ookinetes and disruptants. Oocysts observed with phasecontrast microscopy were smaller than corresponding wild-type oocysts. The oocyst number of the disruptants was approximately 75% of that of wild-type parasites at 2 dpi and decreased to 20%–30% of that of the wild-type parasites at 14 dpi. The average diameter of the oocysts at this time point was approximately 65% of that of wild-type oocysts. Other mutants

Disrupted: Mutant parasite with a disrupted gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_1233200

Gene Model P. falciparum ortholog

PF3D7_0518400

Gene product

cyclin, putative

Gene product: Alternative name

CYC3

top of page

Details of the genetic modification

Inducable system used

Additional remarks inducable system

Type of plasmid/construct used

(Linear) plasmid double cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Partial or complete disruption of the gene

Complete

Additional remarks partial/complete disruption

Selectable marker used to select the mutant parasite

hdhfr

Promoter of the selectable marker

eef1a

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	GTATAACCTACACAAGAGTAGCTAAGC
Additional information primer 1	CTCATCTACAAGCATCgtcgacAATCTTTATGTGTCCTTGGAGG
Sequence Primer 2	CCTTCAATTTCGgatccactagGATAAAAATACTACAGCATCTAC
Additional information primer 2	CATCCATATATTACTCCTAAAACTATATGC
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page