Summary

RMgm-1299
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1119200; Gene model (P.falciparum): PF3D7_0620000; Gene product: secreted ookinete protein 25, putative | ookinete surface-associated protein 8, putative (POS8; putative ookinete surface-associated protein. 8)
Phenotype Oocyst; Sporozoite;
Last modified: 12 June 2015, 22:04
  *RMgm-1299
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26018192
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherKaneko I; Yuda M
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University Graduate School of Medicine
CityTsu, Mie
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-1299
Principal namePOS8(–)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot different from wild type
OocystMore than 20-fold reduction in oocyst numbers.
The size of parasite oocysts was clearly smaller than that of the wild-type parasite oocysts [as observed by phase contrast microscopy at 14 days post-infection (dpi). To identify the step in which they decreased in number, parasites were generated that constitutively expressed GFP from these disruptant populations and the oocysts shortly after ookinete invasion of the midgut at 2 dpi were counted. The number of oocysts was already approximately 10-fold smaller than that of wild-type parasites.We further measured oocyst diameters by epifluorescence microscopy at 14 dpi. The average oocyst diameter was approximately 60% of that of the wild-type oocysts, suggesting that oocyst development was impaired by this disruption.
SporozoiteStrongly reduced sporozoite formation
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of POS8 (putative ookinete surface-associated protein, 9)

Protein (function)
The protein was identified in a genome-wide screen of target genes of AP2-O by chromatin immunoprecipitation-sequencing.

Phenotype
The successful knock-out of pos8 indicates it has no essential role during blood stage development/multiplication. The mutant produced normal numbers of ookinetes. More than 20-fold reduction in oocyst numbers. The size of parasite oocysts was clearly smaller than that of the wild-type parasite oocysts [as observed by phase contrast microscopy at 14 days post-infection (dpi). To identify the step in which they decreased in number, parasites were generated that constitutively expressed GFP from these disruptant populations and  the oocysts shortly after ookinete invasion of the midgut at 2 dpi were counted. The number of oocysts was already approximately 10-fold smaller than that of wild-type parasites.We further measured oocyst diameters by epifluorescence microscopy at 14 dpi. The average oocyst diameter was approximately 60% of that of the wild-type oocysts, suggesting that oocyst development was impaired by this disruption.

Additional information

Other mutants
RMgm-1300: A mutant expressing a GFP-tagged version of POS8


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1119200
Gene Model P. falciparum ortholog PF3D7_0620000
Gene productsecreted ookinete protein 25, putative | ookinete surface-associated protein 8, putative
Gene product: Alternative namePOS8; putative ookinete surface-associated protein. 8
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GTGAGCATATGCATTCGGATAAGAAG
Additional information primer 1CTCATCTACAAGCATCgtcgacAGGAACAACGATAGGAAAGTAC
Sequence Primer 2CCTTCAATTTCGgatccactagGCATAGCCTCTAAATTAATGTC
Additional information primer 2GCTGCAGAACCTTATGAAACCATTGC
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6