RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-1297
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1006400; Gene model (P.falciparum): PF3D7_0408800; Gene product: conserved Plasmodium protein, unknown function (POS7; putative ookinete surface-associated protein. 7)
PhenotypeNo phenotype has been described
Last modified: 12 June 2015, 21:40
  *RMgm-1297
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26018192
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherKaneko I; Yuda M
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University Graduate School of Medicine
CityTsu, Mie
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-1297
Principal namePOS7(–)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of POS7 (putative ookinete surface-associated protein, 7)

Protein (function)
The protein was identified in a genome-wide screen of target genes of AP2-O by chromatin immunoprecipitation-sequencing.

Phenotype
The successful knock-out of pos7 indicates it has no essential role during blood stage development/multiplication. The mutant produced normal numbers of ookinetes/oocysts.

Additional information

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1006400
Gene Model P. falciparum ortholog PF3D7_0408800
Gene productconserved Plasmodium protein, unknown function
Gene product: Alternative namePOS7; putative ookinete surface-associated protein. 7
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGTTTAATAATTGAGTCCACATTTCTAC
Additional information primer 1CTCATCTACAAGCATCgtcgacCCATATGTGCTGGTTATTTGTA
Sequence Primer 2CCTTCAATTTCGgatccactagGAAAAGGAAGACGATGAGTATG
Additional information primer 2GTTTATATAGCTAAAAATAGTGGGTAAC
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6