RMgmDB - Rodent Malaria genetically modified Parasites
SummaryRMgm-129
|
||||||||
Last modified: 7 June 2009, 14:03
*RMgm-129| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Introduction of a transgene |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 15935755 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | S.M. Khan, G.R. Mair, C.J. Janse, A.P. Waters |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center (LUMC) |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-129 |
| Principal name | 501 |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | No |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | GFP expression in female gametocytes. No expression could be detected in asexual blood stages and male gametocytes. |
| Fertilization and ookinete | Not tested |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation The NIMA-related protein kinases (Neks) constitute an extended family of eukaryotic mitotic serine/threonine kinases. The best characterized members of the Nek family include NIMA (never in mitosis/Aspergillus), the founding member from the fungus Aspergillus nidulans, and its closest homologue in mammals, Nek2. Initially identified as a kinase essential for mitotic entry in Aspergillus, NIMA has been also shown to participate in nuclear membrane fission. Eleven members of the NIMA kinase family (Nek1-11) have now been identified in various human tissues, and together fulfil a number of cell cycle-related functions in centrosome separation, mitosis, meiosis and checkpoint control. The P. falciparum kinome includes four NIMA-related serine/threonine kinases. Pfnek-1 (PlasmoDB identifier PFL1370w) clusters within the Aspergillus NIMA/human Nek2 branch in phylogenetic trees, while clear orthology to mammalian or yeast Neks could not be assigned for the three other P. falciparum sequences (Pfnek-2, -3 and -4, PlasmoDB identifiers PFE1290w, PFL0080c and MAL7P1.100,respectively). Additional information |
Transgene: Mutant parasite expressing a transgene| top of page | |||||||||||||||||||
| Type and details of transgene | |||||||||||||||||||
| Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
| Transgene name | GFP (gfp-mut3) | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||
| Type of plasmid/construct | Plasmid single cross-over | ||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
| Plasmid/construct map |
  
| ||||||||||||||||||
| Plasmid/construct sequence |
ATCAAGAGTCTTTTGAAAGCCGAGCAAAAGTGTTAAAATTGATTAAATATATTTTTTAAA
| ||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||
| Additional remarks genetic modification | The construct GFPcon (RMgm-5) containing GFP under the control of the eef1a promoter formed the basis for the construct driving expression of GFP under control of the nek4 promoter. This constructs contains a c/d-ssurrna target fragment for integration into the c/d-rrna genomic locus. GFP is flanked by the 3'-UTR sequence of the dhfr gene of P. berghei. The eef1a promoter region is replaced by a 678 bp fragment (EcoRV/BamHI) of the promoter region of nek4. Because it has been shown that 3'-UTR regions can influence expression of genes in Plasmodium, care has to be taken in interpretation of expression of transgenes when 3'-UTR sequences of heterologous genes are used. The gfp gene has been integrated into the genome by single cross-over integration. Therefore the possibility exists of reversion to the wild-type genotype by removal of the integrated DNA construct. | ||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Other details transgene | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Promoter | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_0616700 | ||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0719200 | ||||||||||||||||||
| Gene product | NIMA related kinase 4 | ||||||||||||||||||
| Gene product: Alternative name | |||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||
| 3'-UTR | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
| Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
| Gene product: Alternative name | dhfr/ts | ||||||||||||||||||
| |||||||||||||||||||
| Insertion/Replacement locus | |||||||||||||||||||
| Replacement / Insertion | Insertion locus | ||||||||||||||||||
| Gene Model of Parasite | Not available | ||||||||||||||||||
| Gene product | Not available | ||||||||||||||||||
| Gene product: Alternative name | small subunit ribosomal rna gene (c- or d-type unit) | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||