RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1289
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1225400; Gene model (P.falciparum): PF3D7_0805200; Gene product: gamete release protein, putative | IMC-associated apicomplexan protein, putative (GAMER; IAAP)
Phenotype Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 11 June 2015, 21:04
  *RMgm-1289
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26018192
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherKaneko I; Yuda M
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University Graduate School of Medicine
CityTsu, Mie
CountryJapan
top of page
Name of the mutant parasite
RMgm numberRMgm-1289
Principal nameIAAP(–)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteThe mutants developed into ookinetes with normal conversion rates. However, the morphology of ookinetes appeared somewhat laterally longer than those of the wild-type parasites. Calculation of the height—width ratios of these ookinetes confirmed that they had abnormal morphologies.
OocystStrongly reduced oocyst production.
SporozoiteStrongly reduced sporozoite production.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of GAMER/IAAP (gamete release protein, putative; IMC-associated apicomplexan protein, putative)

Protein (function)
GAMER encodes a small 96 amino acid protein (10.7 kD) lacking recognizable domains, as revealed by both manual annotation and three-dimensional (3D) homology modeling.

Phenotype
The successful knock-out of gamer/iaap indicates it has no essential role during blood stage development/multiplication. The mutants developed into ookinetes with normal conversion rates. However, the morphology of ookinetes appeared somewhat laterally longer than those of the wild-type parasites. Calculation of the height—width ratios of these ookinetes confirmed that they had abnormal morphologies. Strongly reduced oocyst and sporozoite production.

Additional information
RMgm-1127: Another mutant lacking expression of GAMER/IAAP (with a different phenotype, i.e. affected male gamete development and reduced ookinete production!!)

Other mutants
RMgm-1127: Another mutant lacking expression of GAMER/IAAP (with a different phenotype!!)
RMgm-1228: A mutant expressing a GFP-tagged version of GAMER/IAAP

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1225400
Gene Model P. falciparum ortholog PF3D7_0805200
Gene productgamete release protein, putative | IMC-associated apicomplexan protein, putative
Gene product: Alternative nameGAMER; IAAP
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAGCTATTTACCATAACATGTAACG
Additional information primer 1CTCATCTACAAGCATCgtcgacAAATCCGTTGAATTCGCTTTCC
Sequence Primer 2CCTTCAATTTCGgatccactagCGCGAAAGGGGTTATGTTGTG
Additional information primer 2ATACTAGTAGAGACTATACTTCATG
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren